G30688



Basic Information


Item Value
gene id G30688
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000004
NCBI id null
chromosome length 17451736
location 10436230 ~ 10447737 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU34700
TAAGAGGTAGCCCAAACACATGTCCAATGTAAACTCATGAAGAGCGCTTGGAGGCTAATATCTTGGATGGACTGGGACTGGAATCACAGGTACATGCACTGACCTAATCCAGGGAGAGCATCTGCACCTCTCTCACTCTGTAGGCTGATGTTCACGACTCTGTCCCTTTTCTGCTGGCCTCCAGCACCTATACGTGGCTTACAGCAGAGGAACATTTAAGCTACAAAGTCCATCACCCCAAAACCAGAAGAGTTTCAGTTGGAAGGTTCCTTACCAAAGGAGCCACTTTGCTATTTAGGCACAGCTTTTTAAAATTATCGTCTGCTGGACTCTTCTGCTGTGGTGAGCAAGGAGCATCCATCTACAAGAAAAAGACATCAAATTTTCTCATATACAAATGTTGGTTTCACTTTATTAATGCAGACATCTCATAGATGCAGTTGTTTTTATACAGAGGTCATGATATTTGCTAAACTCCAAACAATTTGCTGAAAATGAAAATAAATCAACCTTAATGAGGACCACATAAA

Function


GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA


RNA id representative length rna type GC content exon number start site end site
TU34700 True 530 lncRNA 0.42 2 10436230 10447737
Loading

Neighbor


gene id symbol gene type direction distance location
CI01000004_10434104_10435287 PTF1A coding upstream 661 10431833 ~ 10435569 (+)
CI01000004_10376389_10423302 DLGAP1A, DLGAP1 coding upstream 12928 10376389 ~ 10423302 (+)
CI01000004_10169407_10212947 CDH18 coding upstream 223041 10169407 ~ 10213189 (+)
CI01000004_10058538_10090881 CDH12A coding upstream 345181 10058538 ~ 10091049 (+)
CI01000004_09980195_09995816 CDH10A coding upstream 440337 9980195 ~ 9995893 (+)
CI01000004_10514814_10550774 NA coding downstream 67077 10514814 ~ 10550920 (+)
CI01000004_10582152_10586349 HTR5AB, HTR5A, HTR5AA coding downstream 134384 10582121 ~ 10586553 (+)
CI01000004_10610634_10613290 ENG2B coding downstream 162043 10609780 ~ 10613630 (+)
CI01000004_10630265_10647904 NA coding downstream 182528 10630265 ~ 10647904 (+)
CI01000004_10683400_10692323 NA coding downstream 235663 10683400 ~ 10692565 (+)
G30681 NA non-coding upstream 91252 10208466 ~ 10344978 (+)
G30515 NA non-coding upstream 529684 9906238 ~ 9906546 (+)
G30505 NA non-coding upstream 546474 9889529 ~ 9889756 (+)
G30447 NA non-coding upstream 620145 9815811 ~ 9816085 (+)
G30780 NA non-coding downstream 5865 10453602 ~ 10454260 (+)
G30787 NA non-coding downstream 27013 10474750 ~ 10474951 (+)
G30689 NA non-coding downstream 246180 10693917 ~ 10697207 (+)
G30839 NA non-coding downstream 253487 10701224 ~ 10701436 (+)
G30678 NA non-coding downstream 284650 10732387 ~ 10736123 (+)
CI01000004_08976512_08980033 TTPA other upstream 1455246 8976254 ~ 8980984 (+)
G28859 NA other upstream 1836627 8599235 ~ 8599603 (+)
CI01000004_08414451_08436256 NA other upstream 1985003 8414316 ~ 8439933 (+)
CI01000004_07654234_07655677 MRPL34 other upstream 2779847 7654234 ~ 7656383 (+)
CI01000004_06571261_06572539 SEP15 other upstream 3861809 6570771 ~ 6572667 (+)
G30797 NA other downstream 49639 10497376 ~ 10497788 (+)
G31710 NA other downstream 1189514 11637251 ~ 11642400 (+)
CI01000004_11666900_11667179 NA other downstream 1217036 11666900 ~ 11667659 (+)
G31865 NA other downstream 1744393 12192130 ~ 12197418 (+)
CI01000004_12646972_12652534 NA other downstream 2195017 12646838 ~ 12652570 (+)

Expression


G30688 Expression in PRJCA010000

Bar chart with 27 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 8.
End of interactive chart.

G30688 Expression in each Bioproject

Bar chart with 28 bars.
G30688 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 1250.
End of interactive chart.

Co-expression Network