G30797



Basic Information


Item Value
gene id G30797
gene name NA
gene type unknown
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000004
NCBI id null
chromosome length 17451736
location 10497376 ~ 10497788 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU34813
GTCCCCTCAAAATAACTCAACACACAGCCATTAATGTCTAAACTGCTGGCCACAAAAGTGAGTCAATATTTTGTGTGGCCACCATTATTTTCCAGCACTGCCTTAACCCTCTTGGGCATGGAGTTCATCAGAGCTTCACAGGTTGCCACTGGAGTCCTCTTCCACTCCTCCATGACGACATCACGGAGCTGGTGGATGTTAGAGACCTTGCGCTCCTCCACCTTCCGTTTGAGGATGCCCCACAGATGCTCAATAGGGTTTAGGTCTGGAGACATGCTTGGCCAGTCCATCACCTTTACCCTCAGCTTCTTTAGCAAGGCAGTGGTCGTCTTGGAGGTGTGTTTGGGGTCGTTATCATGTTGGAATACTGCCC

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU34813 True 373 TUCP 0.50 2 10497376 10497788
Loading

Neighbor


gene id symbol gene type direction distance location
CI01000004_10434104_10435287 PTF1A coding upstream 61807 10431833 ~ 10435569 (+)
CI01000004_10376389_10423302 DLGAP1A, DLGAP1 coding upstream 74074 10376389 ~ 10423302 (+)
CI01000004_10169407_10212947 CDH18 coding upstream 284187 10169407 ~ 10213189 (+)
CI01000004_10058538_10090881 CDH12A coding upstream 406327 10058538 ~ 10091049 (+)
CI01000004_09980195_09995816 CDH10A coding upstream 501483 9980195 ~ 9995893 (+)
CI01000004_10514814_10550774 NA coding downstream 17026 10514814 ~ 10550920 (+)
CI01000004_10582152_10586349 HTR5AB, HTR5A, HTR5AA coding downstream 84333 10582121 ~ 10586553 (+)
CI01000004_10610634_10613290 ENG2B coding downstream 111992 10609780 ~ 10613630 (+)
CI01000004_10630265_10647904 NA coding downstream 132477 10630265 ~ 10647904 (+)
CI01000004_10683400_10692323 NA coding downstream 185612 10683400 ~ 10692565 (+)
G30787 NA non-coding upstream 22425 10474750 ~ 10474951 (+)
G30780 NA non-coding upstream 43116 10453602 ~ 10454260 (+)
G30688 NA non-coding upstream 49639 10436230 ~ 10447737 (+)
G30681 NA non-coding upstream 152398 10208466 ~ 10344978 (+)
G30689 NA non-coding downstream 196129 10693917 ~ 10697207 (+)
G30839 NA non-coding downstream 203436 10701224 ~ 10701436 (+)
G30678 NA non-coding downstream 234599 10732387 ~ 10736123 (+)
G30861 NA non-coding downstream 253046 10750834 ~ 10751295 (+)
G30863 NA non-coding downstream 256169 10753957 ~ 10754306 (+)
CI01000004_08976512_08980033 TTPA other upstream 1516392 8976254 ~ 8980984 (+)
G28859 NA other upstream 1897773 8599235 ~ 8599603 (+)
CI01000004_08414451_08436256 NA other upstream 2046149 8414316 ~ 8439933 (+)
CI01000004_07654234_07655677 MRPL34 other upstream 2840993 7654234 ~ 7656383 (+)
CI01000004_06571261_06572539 SEP15 other upstream 3922955 6570771 ~ 6572667 (+)
G31710 NA other downstream 1139463 11637251 ~ 11642400 (+)
CI01000004_11666900_11667179 NA other downstream 1166985 11666900 ~ 11667659 (+)
G31865 NA other downstream 1694342 12192130 ~ 12197418 (+)
CI01000004_12646972_12652534 NA other downstream 2144966 12646838 ~ 12652570 (+)
CI01000004_14036114_14036449 KIAA0040 other downstream 3525759 14035393 ~ 14039142 (+)

Expression


G30797 Expression in PRJCA010000

Bar chart with 27 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 15.
End of interactive chart.

G30797 Expression in each Bioproject

Bar chart with 42 bars.
G30797 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 600.
End of interactive chart.

Co-expression Network