G31172



Basic Information


Item Value
gene id G31172
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000004
NCBI id null
chromosome length 17451736
location 10629944 ~ 10631721 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU35279
CTTGAAATTCATCTCCAGAGGGAGCATTGATTTCGATGTCTAAAACTTCACCAGGGTCCACCTCTGTCTGCTCTTCTTTAGGACATCTGGCTTGGTCTTCAGCAAGGTGTGGAGTTTTGCACACAAGGTATGGCTTTGCAATCGCCTGAACTTTTGGTTTAGAAACACTTTCATCTTGACATCTCATAGTTTCGTTCTCATCATCACTACGCAAAAGGTCATCGTTCAGCTCTTCATCTGATGTGTCCAAGAGATCTTGTTTGGATGTCAGCCAGTCATCCACAAGAATGTCTTCCTCTGAATTACTGTTCATTTCTTGAATTTGATACTTCCCTCTGAAGGTCCTCTCTTTAC

Function


GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA


RNA id representative length rna type GC content exon number start site end site
TU35279 True 354 lncRNA 0.47 4 10629944 10631721

Neighbor


gene id symbol gene type direction distance location
CI01000004_10619819_10627261 CNPY1 coding downstream 2683 10619019 ~ 10627261 (-)
CI01000004_10553379_10573352 PAXIP1 coding downstream 54701 10553037 ~ 10575243 (-)
CI01000004_10458668_10465442 NA coding downstream 164241 10458662 ~ 10465703 (-)
CI01000004_10436514_10438365 NA coding downstream 190485 10436499 ~ 10439459 (-)
CI01000004_10290550_10295288 CAHZ coding downstream 334587 10289863 ~ 10295357 (-)
CI01000004_10692864_10704094 TRPA1A coding upstream 60916 10692637 ~ 10704094 (-)
CI01000004_10757852_10760211 NA coding upstream 125822 10757543 ~ 10761142 (-)
CI01000004_10766385_10766860 TCEB1B, TCEB1, GM14517, TCEB1A coding upstream 134619 10766340 ~ 10766860 (-)
CI01000004_10788659_10809214 JPH1B, JPH1 coding upstream 156938 10788659 ~ 10809805 (-)
CI01000004_10847650_10847940 NA coding upstream 215836 10847557 ~ 10847995 (-)
G31142 NA non-coding downstream 16296 10611819 ~ 10613648 (-)
G31139 NA non-coding downstream 18870 10610283 ~ 10611074 (-)
G31135 NA non-coding downstream 79303 10544634 ~ 10550641 (-)
G31140 NA non-coding downstream 87755 10541949 ~ 10542189 (-)
G31105 NA non-coding downstream 148822 10480817 ~ 10481122 (-)
G31173 NA non-coding upstream 4449 10636170 ~ 10636383 (-)
G31176 NA non-coding upstream 13105 10644826 ~ 10653508 (-)
G31179 NA non-coding upstream 21969 10653690 ~ 10653939 (-)
G31184 NA non-coding upstream 33063 10664784 ~ 10665159 (-)
G31186 NA non-coding upstream 35208 10666929 ~ 10667135 (-)
G30316 NA other downstream 1223023 9377937 ~ 9406921 (-)
G29746 NA other downstream 2271817 8354498 ~ 8358127 (-)
G29656 NA other downstream 2664444 7964364 ~ 7965500 (-)
G29388 NA other downstream 3998037 6631293 ~ 6631907 (-)
CI01000004_06539836_06541252 NA other downstream 4084372 6538904 ~ 6541252 (-)
G31203 NA other upstream 114716 10746437 ~ 10750641 (-)
CI01000004_11407198_11412220 ADCYAP1B, ADCYAP1 other upstream 775744 11406957 ~ 11412907 (-)
G32150 NA other upstream 1144798 11776519 ~ 11780951 (-)
G32207 NA other upstream 1744447 12376168 ~ 12384780 (-)
CI01000004_14543631_14551256 NA other upstream 3919079 14541515 ~ 14551352 (-)

Expression



Co-expression Network