G30861



Basic Information


Item Value
gene id G30861
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000004
NCBI id null
chromosome length 17451736
location 10750834 ~ 10751295 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU34904
AATGCACAACAACATTCACAGTTTGAAACAATGTGTAGGGGAAGGCACTACAGGTGAACATGCTAAAATCCTCTTTTATAAGATAAAATAGTGTAAAATACTATTTTTCATAAGAAACTACAAAACAATTGTATTGTAACATGATGTGCAAAGTACGCAAATTATGCGTAATTTCAACTGGGAGACCAAAGCTCGATTGCTGCTATAAAACTTGTCAAATGTTGCAGTCAGCATTGCTTGATCTTCACTGTAAAGTAGCTAAATACGTAGACTAGGGGAAGGTGTGAGAGCAGATGCCATGTAAATTATTATTTAATACGATAAATTAGTATTTCACAGCACGCGAATTTATATGTGCACAGAAGAACTTATGTCTAGGCTTTGTGTCGAGCCATTTCCTGGCTGTTTGATGAGAACGAGATGTTTATCCATTTTGGTTTTATTGTCCATTTGGCGGATTAG

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU34904 True 462 lncRNA 0.36 1 10750834 10751295
Loading

Neighbor


gene id symbol gene type direction distance location
CI01000004_10736615_10738593 RDH10, RDH10B coding upstream 11808 10736615 ~ 10739026 (+)
CI01000004_10712377_10730563 KCNB2 coding upstream 20271 10712377 ~ 10730563 (+)
CI01000004_10683400_10692323 NA coding upstream 58269 10683400 ~ 10692565 (+)
CI01000004_10630265_10647904 NA coding upstream 102930 10630265 ~ 10647904 (+)
CI01000004_10610634_10613290 ENG2B coding upstream 137204 10609780 ~ 10613630 (+)
CI01000004_10767883_10769627 TMEM70 coding downstream 16588 10767883 ~ 10769753 (+)
CI01000004_10827227_10829982 PI15B, PI15 coding downstream 75667 10826962 ~ 10831024 (+)
CI01000004_10835420_10847343 CRISPLD1B coding downstream 84125 10835420 ~ 10847343 (+)
CI01000004_10867891_10869483 SOCS6B coding downstream 116365 10867660 ~ 10870925 (+)
CI01000004_10888481_10897508 NETO1 coding downstream 137186 10888481 ~ 10897698 (+)
G30678 NA non-coding upstream 14711 10732387 ~ 10736123 (+)
G30839 NA non-coding upstream 49398 10701224 ~ 10701436 (+)
G30689 NA non-coding upstream 53627 10693917 ~ 10697207 (+)
G30787 NA non-coding upstream 275883 10474750 ~ 10474951 (+)
G30780 NA non-coding upstream 296574 10453602 ~ 10454260 (+)
G30863 NA non-coding downstream 2662 10753957 ~ 10754306 (+)
G30864 NA non-coding downstream 3957 10755252 ~ 10755575 (+)
G30870 NA non-coding downstream 10519 10761814 ~ 10763042 (+)
G30872 NA non-coding downstream 26008 10777303 ~ 10777535 (+)
G30889 NA non-coding downstream 63028 10814323 ~ 10814709 (+)
G30797 NA other upstream 253046 10497376 ~ 10497788 (+)
CI01000004_08976512_08980033 TTPA other upstream 1769850 8976254 ~ 8980984 (+)
G28859 NA other upstream 2151231 8599235 ~ 8599603 (+)
CI01000004_08414451_08436256 NA other upstream 2299607 8414316 ~ 8439933 (+)
CI01000004_07654234_07655677 MRPL34 other upstream 3094451 7654234 ~ 7656383 (+)
G31710 NA other downstream 885956 11637251 ~ 11642400 (+)
CI01000004_11666900_11667179 NA other downstream 913478 11666900 ~ 11667659 (+)
G31865 NA other downstream 1440835 12192130 ~ 12197418 (+)
CI01000004_12646972_12652534 NA other downstream 1891459 12646838 ~ 12652570 (+)
CI01000004_14036114_14036449 KIAA0040 other downstream 3272252 14035393 ~ 14039142 (+)

Expression


G30861 Expression in PRJCA010000

Bar chart with 27 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 1.25.
End of interactive chart.

G30861 Expression in each Bioproject

Bar chart with 30 bars.
G30861 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 30.
End of interactive chart.

Co-expression Network