hes2.1 (hes2.1,LOC107748974,LOC107687139,LOC107577158)


Basic Information

Item Value
gene id hes2.1
gene name hes2.1,LOC107748974,LOC107687139,LOC107577158
gene type coding
species tiger barb (Puntius tetrazona)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_056706.1
NCBI id CM032075.1
chromosome length 24299999
location 23740350 ~ 23741231 (+)
genome version ASM1883169v1_2021_tiger_barb_Genome

Sequence

>XM_043247984.1
TCATTCGGTTCTCGAATGACTGTGGCTCAGAGAAAAGAGGCACACGAATTGAGAAAGACTCTCAAGCCATTGATGGAAAAAAGAAGGCGAGCTCGCATTAACGAGAGCCTCAATCACTTAAAAACACTCATACTCCCTCTGGTCGGCAAAGACGCTTCATGCTATTCAAAGCTGGAGAAAGCCGACATTCTCGAAATGACTGTGCGGTTCCTCAGAGACCTGCCTTCCTCGTCAGCTAAAGGTCAAACAGACAGCTACAAAGAGGGATATAAAGCCTGCTTGCAGCGCATCTCCGCGATGCTGCCGCAGTCTAACATCGAAACGCAAACCCGTCAACGCGTCAACGAGTTCATTCAGCACTCGATGGCGTCTGCGACGTCCTCCTGCCAGAACTGCTGTGCTCAGAACTCCAGAATGATTTCCCAAATGCACCAGAGACTTGTAAGCATGAGGAGCAACAGCTATGCGACGGAGAACCAGTCCACGGGCACCGCGTCTGCTCCCAGCCAACCCCAGCCTGCGCCGCAGGAAGCTGTGGACATGTGGAGACCGTGGTGA

Function

symbol description
hes2.1 Predicted to enable DNA-binding transcription factor activity, RNA polymerase II-specific and RNA polymerase II cis-regulatory region sequence-specific DNA binding activity. Predicted to be involved in anterior/posterior pattern specification; regulation of neurogenesis; and regulation of transcription by RNA polymerase II. Predicted to be active in nucleus. Is expressed in eye; gill; gonad; heart; and liver. Orthologous to human HES2 (hes family bHLH transcription factor 2).

NR:

description
PREDICTED: transcription factor HES-2-like

GO:

id name namespace
GO:0046983 protein dimerization activity molecular_function

KEGG:

id description
K09087 HES2_6_7; hairy and enhancer of split 2/6/7

RNA

RNA id representative length rna type GC content exon number start site end site
XM_043247984.1 True 558 mRNA 0.53 4 23740350 23741231

Neighbor

gene id symbol gene type direction distance location
ybx1 ybx1,LOC107595774,LOC107748958,LOC107693424,LOC107602459 coding upstream 75916 23658081 ~ 23664434 (+)
ppih ppih,LOC107595772,LOC107602460 coding upstream 83499 23635149 ~ 23656851 (+)
dpp9 dpp9 coding upstream 127847 23598728 ~ 23612503 (+)
si:ch211-251b21.1 si:ch211-251b21.1,LOC107748962,LOC107595769,LOC107687113,LOC107691059,LOC107602462,LOC107755276 coding upstream 143219 23586529 ~ 23597131 (+)
plch2a LOC107687112,LOC107595766,LOC107691057,LOC107748961,LOC107602463 coding upstream 156973 23482895 ~ 23583377 (+)
hes2.2 LOC107595804,LOC107748990,LOC107687144,LOC107734829 coding downstream 9015 23750246 ~ 23752431 (+)
LOC122350042 acot7 coding downstream 87435 23828666 ~ 23864915 (+)
LOC122350978 gpr153,LOC107687122,LOC107693426 coding downstream 130005 23871236 ~ 23900075 (+)
LOC122351094 sult1st3,LOC107727994,LOC107594958,LOC107727992,LOC107687124,LOC107687147,LOC107687125 coding downstream 201530 23942761 ~ 23953590 (+)
LOC122350539 sult1st3,LOC107727992,LOC107687125,LOC107687124,LOC107594958,LOC107738928,LOC107727989 coding downstream 214817 23956048 ~ 23963140 (+)
LOC122350145 NA non-coding upstream 58518 23676434 ~ 23681832 (+)
G66418 LOC107748960,LOC107687117,LOC107691060,LOC107595771,LOC107602461,LOC107755278 non-coding upstream 116879 23620927 ~ 23623471 (+)
G66416 NA non-coding upstream 123668 23615216 ~ 23616682 (+)
G66351 NA non-coding upstream 305317 23434118 ~ 23435033 (+)
G66350 NA non-coding upstream 306605 23432809 ~ 23433745 (+)
ndufa7 ndufa7,LOC107748992,LOC107755274 other upstream 106285 23632350 ~ 23634065 (+)
LOC122350936 LOC107710771,LOC106926566,LOC107691064 other upstream 329789 23403713 ~ 23410561 (+)
prdm16 prdm16,si:ch211-263k4.2 other upstream 338788 23054616 ~ 23401562 (+)
mfn2 mfn2,LOC107748965,LOC107602467,LOC107710790,LOC107678429,LOC107698839,LOC107595787 other upstream 753188 22973995 ~ 22987162 (+)
wrap73 LOC107748967,LOC107698846,LOC107595759,LOC107678416,LOC107602469,LOC107710786 other upstream 814582 22899436 ~ 22925768 (+)
acot7 acot7,LOC107754737,LOC107687121,LOC107693425 other downstream 11337 23752568 ~ 23804049 (+)

Expression


Co-expression Network