LOC122350292 (hnf1a,LOC107687971,LOC107550982,LOC107712475)


Basic Information

Item Value
gene id LOC122350292
gene name hnf1a,LOC107687971,LOC107550982,LOC107712475
gene type non-coding
species tiger barb (Puntius tetrazona)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_056706.1
NCBI id CM032075.1
chromosome length 24299999
location 18096095 ~ 18103013 (-)
genome version ASM1883169v1_2021_tiger_barb_Genome

Sequence

>XR_006251591.1
CTGGGTTCAAGTTGGACCGGACTAGTTAGACGGCCGCCTCTGTCTTCACCGCTGGAGCTTCTTACTGTGCCCAGACTCTCGCACACCACCGGCTGGCTGTACTTCAAAACTTAAGGATATCAACAAAAGAGAAAGGCCTGGAACAGGATTTGTTGGGACGCCGGGCCCCATTTGAATCGATTCCTCCGTCCCTTTCTCACATCCTCCCCAGATTCCTCTCCCGACATGACGCCTCGACTGGCATTGGTGAACTCTGCATTGATCAGGCTGTACAGAGCAGCTCGCTTTTGATTCTTCATGGGTGTGCCCTTGTTAAGGTGCTGGGAGAGATGGGATTGGTTGAGGCCTGTGGACTCCACCACCTCTCTCTGTGTGGTAGCCCACTTGACAACAGCGATAAACCCGTCTGACGAATCTGAAGAGGGGCTGTTCCGGGAAAACGGCACGACGCGGAGCGTCGCTCATCGTCGACAGTATCTTCAGACGGTACATCTGGC

Function

symbol description
hnf1a Predicted to enable DNA-binding transcription factor activity, RNA polymerase II-specific; RNA polymerase II cis-regulatory region sequence-specific DNA binding activity; and protein dimerization activity. Acts upstream of or within type B pancreatic cell development. Predicted to be active in nucleus. Human ortholog(s) of this gene implicated in glucose metabolism disease (multiple); liver disease (multiple); and renal cell carcinoma. Orthologous to human HNF1A (HNF1 homeobox A).

NR:

description
PREDICTED: hepatocyte nuclear factor 1-alpha isoform X3

GO:

id name namespace
GO:0045893 positive regulation of transcription, DNA-templated biological_process
GO:0005634 nucleus cellular_component
GO:0043565 sequence-specific DNA binding molecular_function
GO:0003700 DNA-binding transcription factor activity molecular_function
GO:0046983 protein dimerization activity molecular_function

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
XR_006251591.1 True 497 lncRNA 0.55 4 18096095 18103013

Neighbor

gene id symbol gene type direction distance location
si:ch211-170d8.8 LOC107712454,LOC107687991,LOC107550941,LOC107554434 coding downstream 13478 18079945 ~ 18082617 (-)
asgrl1 LOC107580964 coding downstream 16612 18075597 ~ 18079483 (-)
si:dkey-63d15.12 NA coding downstream 39818 18053359 ~ 18056277 (-)
LOC122350049 LOC107748126,LOC107553823,LOC107687983,LOC107549670,LOC107697074,LOC107697075 coding downstream 389604 17701512 ~ 17706491 (-)
crybb2 crybb2,LOC107565327,LOC107753119,LOC107684510,LOC107553840,LOC107687964,LOC107748132 coding downstream 396680 17697175 ~ 17699415 (-)
LOC122349911 LOC107569538,LOC107747839,LOC107694233,LOC107554410,LOC107703160 coding upstream 28481 18131494 ~ 18143145 (-)
LOC122351022 NA coding upstream 55284 18158297 ~ 18162389 (-)
c8h12orf43 NA coding upstream 83245 18186258 ~ 18188684 (-)
unc119.1 unc119b,unc119.1,LOC107753165,LOC107712459,LOC107550938,LOC107687994 coding upstream 87482 18190495 ~ 18196236 (-)
mlec mlec,LOC107687973,LOC107703166,LOC107712476,LOC107550980,LOC107554429 coding upstream 94013 18197026 ~ 18204992 (-)
G64942 lzts1,LOC107712471,LOC107687967,LOC107550927,LOC107554439,LOC107753115,LOC107703152 non-coding downstream 63369 18029535 ~ 18032726 (-)
G64777 NA non-coding downstream 350171 17745685 ~ 17745924 (-)
G64757 NA non-coding downstream 430963 17661349 ~ 17665132 (-)
LOC122350842 NA non-coding downstream 435117 17657809 ~ 17660978 (-)
G64724 NA non-coding downstream 683223 17411009 ~ 17412872 (-)
G64966 NA non-coding upstream 23172 18126185 ~ 18128804 (-)
G64992 NA non-coding upstream 182472 18285485 ~ 18285734 (-)
G65010 NA non-coding upstream 262426 18365439 ~ 18365779 (-)
G65011 NA non-coding upstream 264413 18367426 ~ 18367640 (-)
G65012 dusp2,LOC107657330,LOC107550972,LOC107712482,LOC107753144,LOC107554416,LOC107703175,LOC108265928 non-coding upstream 350568 18453581 ~ 18459309 (-)
kcnip3a kcnip3a,LOC108440810,LOC107684506,LOC107553838,LOC107566017,LOC102307840,LOC108264878,LOC101482209,LOC103397788,LOC107753121,LOC107687962,LOC102210345,LOC108233759,LOC102228939,LOC102799407,LOC104951840,LOC102798027 other downstream 450584 17601258 ~ 17645511 (-)
LOC122350953 NA other downstream 694867 17320376 ~ 17401228 (-)
zgc:194007 NA other downstream 734245 17359385 ~ 17361850 (-)
LOC122350945 drd2b,LOC107745132,LOC107705176,LOC107691748,LOC107664308,LOC107600777,LOC107556418,LOC108428674 other downstream 999300 17046467 ~ 17096795 (-)
LOC122350093 NA other downstream 1686399 16407834 ~ 16409696 (-)
LOC122350290 LOC107569538,LOC107747839,LOC107554410,LOC107703160,LOC107694233 other upstream 4440 18107453 ~ 18112701 (-)
G64967 NA other upstream 52122 18155135 ~ 18157543 (-)
tbc1d10aa tbc1d10aa,LOC107657331,LOC107712481,LOC107550973,LOC107753095,LOC107703173,LOC107554420 other upstream 287650 18390663 ~ 18401938 (-)
G65033 NA other upstream 456654 18559667 ~ 18560334 (-)
LOC122350102 LOC107717958,LOC107676625,LOC107550916,LOC107682323,LOC107659265 other upstream 920700 19023713 ~ 19047969 (-)

Expression


Co-expression Network