G31664



Basic Information


Item Value
gene id G31664
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000004
NCBI id null
chromosome length 17451736
location 11406286 ~ 11406611 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU35877
ATAAGATTTTCCTTTTGGGATGAAACCCTCAGTCACATGATTTGGCTGGAAGGGAGGGAAAATTAATGACAGAAGATATGAGAGGAGCTAGAGAGTGTCTTTAGGTGTACTGGCTCAGATGGAGTATCCTAAATTGTCCTAAATACATGCTTTTCTTCCAGGACGGACTGTAGCAAGAGTATTAGCTTATGTTGAAGGTGCAGCACACCAAACAAAACGCGTTTTCATTTATGCATTTGGCAATCACTCTCATGCAAATTGACTTAAATTGCACTGAAAGTGTACATTTTATCAGTTCAAGCTATCCTTGGGAATCTAACCCATGG

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU35877 True 326 lncRNA 0.32 1 11406286 11406611
Loading

Neighbor


gene id symbol gene type direction distance location
CI01000004_11215878_11229028 LIPIN2, LPIN2 coding upstream 177164 11215682 ~ 11229122 (+)
CI01000004_11181665_11204466 MYOM1A coding upstream 200210 11181665 ~ 11206343 (+)
CI01000004_11168348_11170417 BAG1 coding upstream 235512 11168348 ~ 11170774 (+)
CI01000004_11163514_11166543 NA coding upstream 239743 11162918 ~ 11166543 (+)
CI01000004_11155692_11159471 OPRK1 coding upstream 245786 11154644 ~ 11160500 (+)
CI01000004_11432849_11451784 MGC115231, YES1.L, YES1 coding downstream 26238 11432849 ~ 11452991 (+)
CI01000004_11489380_11502517 COLEC12 coding downstream 82769 11489380 ~ 11502868 (+)
CI01000004_11505808_11516796 STAM coding downstream 99197 11505808 ~ 11518182 (+)
CI01000004_11520078_11522835 NA coding downstream 113316 11519927 ~ 11523093 (+)
CI01000004_11547197_11557429 CACNB2B coding downstream 140586 11547197 ~ 11560552 (+)
G31663 NA non-coding upstream 21 11405919 ~ 11406265 (+)
G31662 NA non-coding upstream 530 11405164 ~ 11405756 (+)
G31575 NA non-coding upstream 78863 11327118 ~ 11327423 (+)
G31426 NA non-coding upstream 111669 11294359 ~ 11294617 (+)
G31425 NA non-coding upstream 112154 11293900 ~ 11294132 (+)
G31665 NA non-coding downstream 63 11406674 ~ 11406905 (+)
G31677 NA non-coding downstream 59425 11466036 ~ 11466371 (+)
G31690 NA non-coding downstream 109200 11515811 ~ 11566155 (+)
G31721 NA non-coding downstream 286244 11692855 ~ 11694150 (+)
G30797 NA other upstream 908498 10497376 ~ 10497788 (+)
CI01000004_08976512_08980033 TTPA other upstream 2425302 8976254 ~ 8980984 (+)
G28859 NA other upstream 2806683 8599235 ~ 8599603 (+)
CI01000004_08414451_08436256 NA other upstream 2955059 8414316 ~ 8439933 (+)
CI01000004_07654234_07655677 MRPL34 other upstream 3749903 7654234 ~ 7656383 (+)
G31710 NA other downstream 230640 11637251 ~ 11642400 (+)
CI01000004_11666900_11667179 NA other downstream 258162 11666900 ~ 11667659 (+)
G31865 NA other downstream 785519 12192130 ~ 12197418 (+)
CI01000004_12646972_12652534 NA other downstream 1236143 12646838 ~ 12652570 (+)
CI01000004_14036114_14036449 KIAA0040 other downstream 2616936 14035393 ~ 14039142 (+)

Expression


G31664 Expression in PRJCA010000

Bar chart with 27 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 2.
End of interactive chart.

G31664 Expression in each Bioproject

Bar chart with 7 bars.
G31664 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 60.
End of interactive chart.

Co-expression Network