G31677



Basic Information


Item Value
gene id G31677
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000004
NCBI id null
chromosome length 17451736
location 11466036 ~ 11466371 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU35890
TTCTATATGTAGCATTTATATAGATCTACAGTATATGTAACCCTGGACCACAAAACCAGGCATAAAGGTCAATTTTTTGAAATTGAGATTTATACATCATCTGAAAGCTGAATAAATAAGCTTTCCATTGAAGTATGGTTTGTTAGGATAGGACAATATTTGGCCAAGATACAACTATTTGGAATCTGAGGGTGCAAAAAAATCAAAATATTGAGAAAATTGCCTTTAAAGTTGTCCAAATAAAGTCCTTAGCAATGCTTATCCACTCACAAAAATACATTTTTGATATATTTACGGTAGGAAATGTACAAAATATCTTCATGGAACATGATTTTC

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU35890 True 336 lncRNA 0.32 1 11466036 11466371
Loading

Neighbor


gene id symbol gene type direction distance location
CI01000004_11432849_11451784 MGC115231, YES1.L, YES1 coding upstream 13045 11432849 ~ 11452991 (+)
CI01000004_11215878_11229028 LIPIN2, LPIN2 coding upstream 236914 11215682 ~ 11229122 (+)
CI01000004_11181665_11204466 MYOM1A coding upstream 259960 11181665 ~ 11206343 (+)
CI01000004_11168348_11170417 BAG1 coding upstream 295262 11168348 ~ 11170774 (+)
CI01000004_11163514_11166543 NA coding upstream 299493 11162918 ~ 11166543 (+)
CI01000004_11489380_11502517 COLEC12 coding downstream 23009 11489380 ~ 11502868 (+)
CI01000004_11505808_11516796 STAM coding downstream 39437 11505808 ~ 11518182 (+)
CI01000004_11520078_11522835 NA coding downstream 53556 11519927 ~ 11523093 (+)
CI01000004_11547197_11557429 CACNB2B coding downstream 80826 11547197 ~ 11560552 (+)
CI01000004_11592217_11595358 NA coding downstream 125846 11592217 ~ 11595358 (+)
G31665 NA non-coding upstream 59131 11406674 ~ 11406905 (+)
G31664 NA non-coding upstream 59425 11406286 ~ 11406611 (+)
G31663 NA non-coding upstream 59771 11405919 ~ 11406265 (+)
G31662 NA non-coding upstream 60280 11405164 ~ 11405756 (+)
G31575 NA non-coding upstream 138613 11327118 ~ 11327423 (+)
G31690 NA non-coding downstream 49440 11515811 ~ 11566155 (+)
G31721 NA non-coding downstream 226484 11692855 ~ 11694150 (+)
G31723 NA non-coding downstream 228016 11694387 ~ 11696280 (+)
G31727 NA non-coding downstream 240213 11706584 ~ 11706970 (+)
G30797 NA other upstream 968248 10497376 ~ 10497788 (+)
CI01000004_08976512_08980033 TTPA other upstream 2485052 8976254 ~ 8980984 (+)
G28859 NA other upstream 2866433 8599235 ~ 8599603 (+)
CI01000004_08414451_08436256 NA other upstream 3014809 8414316 ~ 8439933 (+)
CI01000004_07654234_07655677 MRPL34 other upstream 3809653 7654234 ~ 7656383 (+)
G31710 NA other downstream 170880 11637251 ~ 11642400 (+)
CI01000004_11666900_11667179 NA other downstream 198402 11666900 ~ 11667659 (+)
G31865 NA other downstream 725759 12192130 ~ 12197418 (+)
CI01000004_12646972_12652534 NA other downstream 1176383 12646838 ~ 12652570 (+)
CI01000004_14036114_14036449 KIAA0040 other downstream 2557176 14035393 ~ 14039142 (+)

Expression


G31677 Expression in PRJCA010000

Bar chart with 27 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 8.
End of interactive chart.

G31677 Expression in each Bioproject

Bar chart with 39 bars.
G31677 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 600.
End of interactive chart.

Co-expression Network