G31721



Basic Information


Item Value
gene id G31721
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000004
NCBI id null
chromosome length 17451736
location 11692855 ~ 11694150 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU35955
AAAACATTTAACCTACCTGTTAGGTCATTTATTTGATTGTAGGCCAAATTCAGTCTTGTGAGGTTTGTTAGTCCATTAAGTCCTTCTACTTTGGTAATTAAGTTGCAGGACAGGTTTAGGGTGCGCAGTGAGGACAGGGAAGCTAATCCTTCTATACGACAGATGTGATTGGATGACAGGTCCAGATGTCGAATGTGCCATGCTGTCGTCAAGCCTTCAATCTTAGTGAGGCGATTGCAGTGAAGATTCAGGGATGAAATGCTGGGATTCAGTTGGACCTCTAGTAGACTTGAAATATCCTTATCAATTAGACACAGCTCTCCAACAGCCATAACGAAGCTACACAGAGTGAGAACAAGCTTCTGTCTTTATCAACCTGACATGTAGTAAACTTTAACTGCCTGGGTAGGATTCAAAGCTTTCCATTATACTTTACCGCTG

Function


NR:

description
unnamed protein product

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA


RNA id representative length rna type GC content exon number start site end site
TU35955 True 441 lncRNA 0.45 4 11692855 11694150
Loading

Neighbor


gene id symbol gene type direction distance location
CI01000004_11668089_11670426 ACKR4A coding upstream 21933 11667703 ~ 11670922 (+)
CI01000004_11666900_11667179 NA coding upstream 25299 11666900 ~ 11667659 (+)
CI01000004_11622516_11634475 NA coding upstream 57930 11622516 ~ 11634925 (+)
CI01000004_11608619_11618346 MALRD1 coding upstream 74428 11608619 ~ 11618427 (+)
CI01000004_11598169_11606266 MALRD1 coding upstream 86572 11598169 ~ 11606283 (+)
CI01000004_11747225_11747971 RNF182 coding downstream 52386 11746536 ~ 11748095 (+)
CI01000004_11750356_11765031 RANBP9 coding downstream 55615 11749765 ~ 11766104 (+)
CI01000004_11771176_11773391 EPDR1 coding downstream 76939 11771089 ~ 11773516 (+)
CI01000004_11776595_11786233 STARD3NL coding downstream 82269 11776419 ~ 11786917 (+)
CI01000004_11863724_11890961 NA coding downstream 169574 11863724 ~ 11891114 (+)
G31690 NA non-coding upstream 126700 11515811 ~ 11566155 (+)
CI01000004_11547197_11557429 CACNB2B non-coding upstream 132303 11547197 ~ 11560552 (+)
G31677 NA non-coding upstream 226484 11466036 ~ 11466371 (+)
G31665 NA non-coding upstream 285950 11406674 ~ 11406905 (+)
G31664 NA non-coding upstream 286244 11406286 ~ 11406611 (+)
G31723 NA non-coding downstream 237 11694387 ~ 11696280 (+)
G31727 NA non-coding downstream 12434 11706584 ~ 11706970 (+)
G31737 NA non-coding downstream 54375 11748525 ~ 11748761 (+)
G31625 NA non-coding downstream 96847 11790997 ~ 11803727 (+)
G31785 NA non-coding downstream 201703 11895853 ~ 11896129 (+)
G31710 NA other upstream 50455 11637251 ~ 11642400 (+)
G30797 NA other upstream 1195067 10497376 ~ 10497788 (+)
CI01000004_08976512_08980033 TTPA other upstream 2711871 8976254 ~ 8980984 (+)
G28859 NA other upstream 3093252 8599235 ~ 8599603 (+)
G31865 NA other downstream 497980 12192130 ~ 12197418 (+)
CI01000004_12646972_12652534 NA other downstream 948604 12646838 ~ 12652570 (+)
CI01000004_14036114_14036449 KIAA0040 other downstream 2329397 14035393 ~ 14039142 (+)
CI01000004_15091390_15096502 GA45B, GADD45B, GADD45BB other downstream 3397094 15091200 ~ 15097173 (+)
G34220 NA other downstream 4245207 15939357 ~ 15939950 (+)

Expression


G31721 Expression in PRJCA010000

Bar chart with 27 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 2.
End of interactive chart.

G31721 Expression in each Bioproject

Bar chart with 41 bars.
G31721 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 150.
End of interactive chart.

Co-expression Network