G32256


Basic Information

Item Value
gene id G32256
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000004
NCBI id null
chromosome length 17451736
location 12166528 ~ 12166744 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU36594
TGCACTGTGTGTTGTGACACATTCCTCCCATTCATTCCTAACCATCATTAAAATTTTATGTGACTTGTGCCACAGTAGACATTCTGTTGGCTTGATCCAGGCGAGATAGCCTTTGTTGCCCTCATGCATCGATGAGCCTTGGGCGCCCAACACCCTGTCGTGGTGGTTTATCTCTCCTCGGACCACTGTTGGCAAATTCTCACCTCTGCTGACCCAG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU36594 True 217 lncRNA 0.33 1 12166528 12166744

Neighbor

gene id symbol gene type direction distance location
CI01000004_12127993_12144790 SLC4A2A, SLC4A2 coding downstream 21738 12126600 ~ 12144790 (-)
CI01000004_12111607_12123001 UBTFL, UBF1 coding downstream 43210 12110892 ~ 12123318 (-)
CI01000004_12048597_12107143 ASAP1, ASAP1A coding downstream 58327 12047319 ~ 12108201 (-)
CI01000004_12025107_12032154 NA coding downstream 133576 12025107 ~ 12032952 (-)
CI01000004_11974708_11980518 NA coding downstream 184233 11974644 ~ 11982295 (-)
CI01000004_12170772_12177138 TTC19 coding upstream 3773 12170517 ~ 12177138 (-)
CI01000004_12181888_12188055 NA coding upstream 14835 12181579 ~ 12188055 (-)
CI01000004_12191329_12197377 ABCF2B, ABCF2 coding upstream 23890 12190634 ~ 12197377 (-)
CI01000004_12198187_12210149 SMARCD3A, SMARCD3B, SMARCD3 coding upstream 31168 12197912 ~ 12210149 (-)
CI01000004_12228586_12231682 NA coding upstream 61773 12228517 ~ 12232062 (-)
G32240 NA non-coding downstream 174709 11991608 ~ 11991819 (-)
G32239 NA non-coding downstream 178701 11987529 ~ 11987827 (-)
G32238 NA non-coding downstream 180718 11985549 ~ 11985810 (-)
G32237 NA non-coding downstream 181100 11985217 ~ 11985428 (-)
G32231 NA non-coding downstream 205150 11961179 ~ 11961378 (-)
G32177 NA non-coding upstream 11199 12177943 ~ 12179824 (-)
G32258 NA non-coding upstream 29629 12196373 ~ 12197128 (-)
CI01000004_12279303_12308271 PUF60, PUF60A non-coding upstream 101143 12278894 ~ 12308271 (-)
G32200 NA non-coding upstream 115906 12282650 ~ 12286780 (-)
G32261 NA non-coding upstream 185275 12352019 ~ 12352451 (-)
G32150 NA other downstream 385577 11776519 ~ 11780951 (-)
CI01000004_11407198_11412220 ADCYAP1B, ADCYAP1 other downstream 753621 11406957 ~ 11412907 (-)
G31203 NA other downstream 1415887 10746437 ~ 10750641 (-)
G30316 NA other downstream 2759607 9377937 ~ 9406921 (-)
G29746 NA other downstream 3808401 8354498 ~ 8358127 (-)
G32207 NA other upstream 209424 12376168 ~ 12384780 (-)
CI01000004_14543631_14551256 NA other upstream 2384056 14541515 ~ 14551352 (-)
G33746 NA other upstream 2402049 14568793 ~ 14569264 (-)
G33750 NA other upstream 2411714 14578458 ~ 14579001 (-)
G33755 NA other upstream 2414662 14581406 ~ 14581873 (-)

Expression


Co-expression Network