G31939



Basic Information


Item Value
gene id G31939
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000004
NCBI id null
chromosome length 17451736
location 12396391 ~ 12396626 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU36220
CTTCCCGGTCGACTGACATTTGTTAAGACATCTGCTTTAAACATTACAATGCTCACGGTAACTTTCATTAACTCTACAAGAAGTAAATCCACTTCACCAGCTAATTATTCTTTGACAGCGATGCCATAGAAATATACAGAGCTACCGCAAAAACGGAAGTTCAAAGACAATATTCTAAAGATGGCGGCGCGCTTATTTCTCTGGCGCATAAGGTCTATAAGGAGAATAATCCTGGA

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU36220 True 236 lncRNA 0.40 1 12396391 12396626
Loading

Neighbor


gene id symbol gene type direction distance location
CI01000004_12390372_12391923 CCR9A coding upstream 4211 12390372 ~ 12392180 (+)
CI01000004_12376518_12381495 NA coding upstream 14686 12376424 ~ 12381705 (+)
CI01000004_12362858_12363136 NA coding upstream 33255 12362807 ~ 12363136 (+)
CI01000004_12353073_12362622 KLHL18 coding upstream 33675 12352960 ~ 12362716 (+)
CI01000004_12331486_12332789 NA coding upstream 63394 12330840 ~ 12332997 (+)
CI01000004_12412259_12417501 NA coding downstream 15509 12412135 ~ 12417517 (+)
CI01000004_12418456_12419641 NA coding downstream 21070 12417696 ~ 12421019 (+)
CI01000004_12422242_12423747 OPN4.1 coding downstream 25454 12422080 ~ 12424693 (+)
CI01000004_12426409_12429382 TMEM53 coding downstream 29783 12426409 ~ 12429470 (+)
CI01000004_12553125_12559468 NA coding downstream 156148 12552774 ~ 12559876 (+)
G31930 NA non-coding upstream 44909 12351282 ~ 12351482 (+)
G31874 NA non-coding upstream 91522 12302619 ~ 12304869 (+)
G31863 NA non-coding upstream 99382 12278880 ~ 12297009 (+)
G31864 NA non-coding upstream 103696 12239807 ~ 12292695 (+)
G31881 NA non-coding upstream 125902 12269833 ~ 12270489 (+)
G31952 NA non-coding downstream 65904 12462530 ~ 12463374 (+)
G31959 NA non-coding downstream 76497 12473123 ~ 12473405 (+)
G31967 NA non-coding downstream 88072 12484698 ~ 12484906 (+)
G31969 NA non-coding downstream 90307 12486933 ~ 12487443 (+)
G32296 NA non-coding downstream 104852 12501478 ~ 12501881 (+)
G31865 NA other upstream 201244 12192130 ~ 12197418 (+)
CI01000004_11666900_11667179 NA other upstream 728732 11666900 ~ 11667659 (+)
G31710 NA other upstream 753991 11637251 ~ 11642400 (+)
G30797 NA other upstream 1898603 10497376 ~ 10497788 (+)
CI01000004_08976512_08980033 TTPA other upstream 3415407 8976254 ~ 8980984 (+)
CI01000004_12646972_12652534 NA other downstream 246128 12646838 ~ 12652570 (+)
CI01000004_14036114_14036449 KIAA0040 other downstream 1626921 14035393 ~ 14039142 (+)
CI01000004_15091390_15096502 GA45B, GADD45B, GADD45BB other downstream 2694618 15091200 ~ 15097173 (+)
G34220 NA other downstream 3542731 15939357 ~ 15939950 (+)
G33815 NA other downstream 3666789 16063415 ~ 16066464 (+)

Expression


G31939 Expression in PRJCA010000

Bar chart with 27 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 15.
End of interactive chart.

G31939 Expression in each Bioproject

Bar chart with 41 bars.
G31939 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 1000.
End of interactive chart.

Co-expression Network