G32264



Basic Information


Item Value
gene id G32264
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000004
NCBI id null
chromosome length 17451736
location 12419432 ~ 12419839 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU36604
GTTAATTTTTTTTTATTAATATTACAGTTCATCTTATCATAAAAATATTAATCATATCCATTTTTATAAATCTTATAGTTATTTTATAAATCATTTAGAAATGTATTATTTTAGTTAAAACAAAATATTCTTAAAGACAAAACATTTCTGTACACTTTCACACTAGAAAGATGTAATTATGTGGTCAATTGCATTATGTCATTCAAGGATATCTGTCTCACAGGCTTGTAGGTGGAGGTAGGTCAAGTTGCTAGTGGTAATCGGTGATTTTTTAGGTTGATAATCTGTATCTTTACTTTCAGTGGTACCAAGAGCCATGAAGCCCTTGTCAGGTTTGTGCACAATTTCCTTAACACATTGGAGTCCATTTTGTATTCTCGTTCCGGTCCATATCTGGGACTCAATCTC

Function


NR:

description
PREDICTED: pyrroline-5-carboxylate reductase 3 isoform X2

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA


RNA id representative length rna type GC content exon number start site end site
TU36604 True 408 lncRNA 0.31 1 12419432 12419839

Neighbor


gene id symbol gene type direction distance location
CI01000004_12404227_12411145 PRPF4BA coding downstream 7767 12403532 ~ 12411665 (-)
CI01000004_12364142_12368537 BFSP2 coding downstream 50760 12364035 ~ 12368672 (-)
CI01000004_12345221_12345884 NA coding downstream 73123 12344810 ~ 12346309 (-)
CI01000004_12315924_12323953 NRBP2, NRBP2A coding downstream 95479 12314745 ~ 12323953 (-)
CI01000004_12279303_12308271 PUF60, PUF60A coding downstream 111161 12278894 ~ 12308271 (-)
CI01000004_12550061_12550882 NA coding upstream 130047 12549886 ~ 12550931 (-)
CI01000004_12574165_12577698 NA coding upstream 154246 12574085 ~ 12580179 (-)
CI01000004_12748162_12752913 NA coding upstream 328100 12747939 ~ 12753275 (-)
CI01000004_12781663_12809789 NA coding upstream 361686 12781525 ~ 12809789 (-)
CI01000004_12823734_12925962 B4GALT2 coding upstream 403895 12823734 ~ 12925962 (-)
G32261 NA non-coding downstream 66981 12352019 ~ 12352451 (-)
G32200 NA non-coding downstream 132652 12282650 ~ 12286780 (-)
G32258 NA non-coding downstream 222304 12196373 ~ 12197128 (-)
G32177 NA non-coding downstream 239608 12177943 ~ 12179824 (-)
G32266 NA non-coding upstream 3750 12423589 ~ 12423850 (-)
G32267 NA non-coding upstream 4322 12424161 ~ 12424469 (-)
G32276 NA non-coding upstream 39761 12459600 ~ 12459828 (-)
G32278 NA non-coding upstream 40639 12460478 ~ 12462341 (-)
G32281 NA non-coding upstream 47280 12467119 ~ 12467329 (-)
G32207 NA other downstream 34652 12376168 ~ 12384780 (-)
G32150 NA other downstream 638481 11776519 ~ 11780951 (-)
CI01000004_11407198_11412220 ADCYAP1B, ADCYAP1 other downstream 1006525 11406957 ~ 11412907 (-)
G31203 NA other downstream 1668791 10746437 ~ 10750641 (-)
G30316 NA other downstream 3012511 9377937 ~ 9406921 (-)
CI01000004_14543631_14551256 NA other upstream 2130961 14541515 ~ 14551352 (-)
G33746 NA other upstream 2148954 14568793 ~ 14569264 (-)
G33750 NA other upstream 2158619 14578458 ~ 14579001 (-)
G33755 NA other upstream 2161567 14581406 ~ 14581873 (-)
G33756 NA other upstream 2165332 14585171 ~ 14585745 (-)

Expression



Co-expression Network