G31967



Basic Information


Item Value
gene id G31967
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000004
NCBI id null
chromosome length 17451736
location 12484698 ~ 12484906 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU36249
TGTTTAACATTATATTAGATCCGTTTGGTACAGTAGGTCTTTATATATAGGCTGTCTGTTTCATTAATGTTAATCAAACAATTGTGGAATCATGGAAAAAAAGTTGAATATATATTTTTTCCTATAGATATGGGTTTTGACTTGGTTTGTTTCAAATTTGGTGGTATTACCAGGGATTTTAAGGTTTAAGGATTTTAATCGAATGTCCA

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU36249 True 209 lncRNA 0.29 1 12484698 12484906
Loading

Neighbor


gene id symbol gene type direction distance location
CI01000004_12426409_12429382 TMEM53 coding upstream 55228 12426409 ~ 12429470 (+)
CI01000004_12422242_12423747 OPN4.1 coding upstream 60005 12422080 ~ 12424693 (+)
CI01000004_12418456_12419641 NA coding upstream 63679 12417696 ~ 12421019 (+)
CI01000004_12412259_12417501 NA coding upstream 67181 12412135 ~ 12417517 (+)
CI01000004_12393203_12398519 NA coding upstream 85406 12392504 ~ 12399292 (+)
CI01000004_12553125_12559468 NA coding downstream 67868 12552774 ~ 12559876 (+)
CI01000004_12562823_12563491 NA coding downstream 76412 12561318 ~ 12563813 (+)
CI01000004_12594138_12621268 NA coding downstream 108257 12593163 ~ 12621791 (+)
CI01000004_12625701_12630744 NA coding downstream 139415 12624321 ~ 12630926 (+)
CI01000004_12646972_12652534 NA coding downstream 161932 12646838 ~ 12652570 (+)
G31959 NA non-coding upstream 11293 12473123 ~ 12473405 (+)
G31952 NA non-coding upstream 21324 12462530 ~ 12463374 (+)
G31939 NA non-coding upstream 88072 12396391 ~ 12396626 (+)
G31930 NA non-coding upstream 133216 12351282 ~ 12351482 (+)
G31874 NA non-coding upstream 179829 12302619 ~ 12304869 (+)
G31969 NA non-coding downstream 2027 12486933 ~ 12487443 (+)
G32296 NA non-coding downstream 16572 12501478 ~ 12501881 (+)
G32350 NA non-coding downstream 178673 12663579 ~ 12663812 (+)
G32371 NA non-coding downstream 215709 12700615 ~ 12700910 (+)
G32382 NA non-coding downstream 220058 12704964 ~ 12781485 (+)
G31865 NA other upstream 289551 12192130 ~ 12197418 (+)
CI01000004_11666900_11667179 NA other upstream 817039 11666900 ~ 11667659 (+)
G31710 NA other upstream 842298 11637251 ~ 11642400 (+)
G30797 NA other upstream 1986910 10497376 ~ 10497788 (+)
CI01000004_08976512_08980033 TTPA other upstream 3503714 8976254 ~ 8980984 (+)
CI01000004_14036114_14036449 KIAA0040 other downstream 1538641 14035393 ~ 14039142 (+)
CI01000004_15091390_15096502 GA45B, GADD45B, GADD45BB other downstream 2606338 15091200 ~ 15097173 (+)
G34220 NA other downstream 3454451 15939357 ~ 15939950 (+)
G33815 NA other downstream 3578509 16063415 ~ 16066464 (+)

Expression


G31967 Expression in PRJCA010000

Bar chart with 27 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 40.
End of interactive chart.

G31967 Expression in each Bioproject

Bar chart with 33 bars.
G31967 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 1000.
End of interactive chart.

Co-expression Network