G32296



Basic Information


Item Value
gene id G32296
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000004
NCBI id null
chromosome length 17451736
location 12501478 ~ 12501881 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU36636
AATCCACCATTTTGTCCAATAAAGCAGTCAGGGGAGTTAGTAGACTAACGTTGATGGACTTGAACTTGAAAAATTATGTGTACTGACGTCTTTCTGTGGTTGAAATGTGGTTCATTCATGTTTATTTGATGATATAAATGAACTAGTAAGAAGAGATGAGCCGCTTGATCTGAGGCGCTACAGCGATCTGTCACGACACATTAAAGAGCCACAAAACAGTATTTGTTTAAATTTCTTTAAAAATTACAAAATTTGAAATTTGAGACTTTGTTTCATATCAAAAGTAACCTGCTCTGTCTTGTCTGTCGATACGTTGTCAGTGTCCTCTTTGCTCTGCGATGTATTTTTCACTGCGTGAGAATATGATGTGTGTGAGAGCGGCATGGCTTGTCGGACATAGCAAC

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU36636 True 404 lncRNA 0.40 1 12501478 12501881
Loading

Neighbor


gene id symbol gene type direction distance location
CI01000004_12426409_12429382 TMEM53 coding upstream 72008 12426409 ~ 12429470 (+)
CI01000004_12422242_12423747 OPN4.1 coding upstream 76785 12422080 ~ 12424693 (+)
CI01000004_12418456_12419641 NA coding upstream 80459 12417696 ~ 12421019 (+)
CI01000004_12412259_12417501 NA coding upstream 83961 12412135 ~ 12417517 (+)
CI01000004_12393203_12398519 NA coding upstream 102186 12392504 ~ 12399292 (+)
CI01000004_12553125_12559468 NA coding downstream 50893 12552774 ~ 12559876 (+)
CI01000004_12562823_12563491 NA coding downstream 59437 12561318 ~ 12563813 (+)
CI01000004_12594138_12621268 NA coding downstream 91282 12593163 ~ 12621791 (+)
CI01000004_12625701_12630744 NA coding downstream 122440 12624321 ~ 12630926 (+)
CI01000004_12646972_12652534 NA coding downstream 144957 12646838 ~ 12652570 (+)
G31969 NA non-coding upstream 14035 12486933 ~ 12487443 (+)
G31967 NA non-coding upstream 16572 12484698 ~ 12484906 (+)
G31959 NA non-coding upstream 28073 12473123 ~ 12473405 (+)
G31952 NA non-coding upstream 38104 12462530 ~ 12463374 (+)
G31939 NA non-coding upstream 104852 12396391 ~ 12396626 (+)
G32350 NA non-coding downstream 161698 12663579 ~ 12663812 (+)
G32371 NA non-coding downstream 198734 12700615 ~ 12700910 (+)
G32382 NA non-coding downstream 203083 12704964 ~ 12781485 (+)
G32414 NA non-coding downstream 307736 12809617 ~ 12810075 (+)
G32431 NA non-coding downstream 351081 12852962 ~ 12853804 (+)
G31865 NA other upstream 306331 12192130 ~ 12197418 (+)
CI01000004_11666900_11667179 NA other upstream 833819 11666900 ~ 11667659 (+)
G31710 NA other upstream 859078 11637251 ~ 11642400 (+)
G30797 NA other upstream 2003690 10497376 ~ 10497788 (+)
CI01000004_08976512_08980033 TTPA other upstream 3520494 8976254 ~ 8980984 (+)
CI01000004_14036114_14036449 KIAA0040 other downstream 1521666 14035393 ~ 14039142 (+)
CI01000004_15091390_15096502 GA45B, GADD45B, GADD45BB other downstream 2589363 15091200 ~ 15097173 (+)
G34220 NA other downstream 3437476 15939357 ~ 15939950 (+)
G33815 NA other downstream 3561534 16063415 ~ 16066464 (+)

Expression


G32296 Expression in PRJCA010000

Bar chart with 27 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 15.
End of interactive chart.

G32296 Expression in each Bioproject

Bar chart with 43 bars.
G32296 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 1000.
End of interactive chart.

Co-expression Network