G32350



Basic Information


Item Value
gene id G32350
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000004
NCBI id null
chromosome length 17451736
location 12663579 ~ 12663812 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU36699
ATCCGCTCTGTGCTCTCGTGTCTCTGGACCAGAGCAGACTGTGCTCGCGCTGCGGCAGTTCACATTATACTAACGTGAAAACGGACTTCATTCGCGTCAGTGGAAAGCATATTTACACTGTCTGAATCGTTCCCTATTCTCTATATAGTGCACTATGTGCCATTCATGTAGAAACTAGTGAACGTGTGAACAAATGACCGCAGCTTCAGTGTCTGTTGATAGTGTAGGAGGGGG

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU36699 True 234 lncRNA 0.30 1 12663579 12663812
Loading

Neighbor


gene id symbol gene type direction distance location
CI01000004_12646972_12652534 NA coding upstream 11009 12646838 ~ 12652570 (+)
CI01000004_12625701_12630744 NA coding upstream 32653 12624321 ~ 12630926 (+)
CI01000004_12594138_12621268 NA coding upstream 41788 12593163 ~ 12621791 (+)
CI01000004_12562823_12563491 NA coding upstream 99766 12561318 ~ 12563813 (+)
CI01000004_12553125_12559468 NA coding upstream 103703 12552774 ~ 12559876 (+)
CI01000004_12696326_12707951 NA coding downstream 30565 12694377 ~ 12707996 (+)
CI01000004_12719753_12721562 KLF17 coding downstream 54604 12718416 ~ 12722033 (+)
CI01000004_12764916_12775989 SLC6A9 coding downstream 101104 12764916 ~ 12776172 (+)
CI01000004_12810922_12817913 VWC2L.2 coding downstream 146760 12810572 ~ 12818547 (+)
CI01000004_12984968_12997831 KISS1R, KISS1RA, GPR54 coding downstream 321156 12984968 ~ 12998063 (+)
G32296 NA non-coding upstream 161698 12501478 ~ 12501881 (+)
G31969 NA non-coding upstream 176136 12486933 ~ 12487443 (+)
G31967 NA non-coding upstream 178673 12484698 ~ 12484906 (+)
G31959 NA non-coding upstream 190174 12473123 ~ 12473405 (+)
G31952 NA non-coding upstream 200205 12462530 ~ 12463374 (+)
G32371 NA non-coding downstream 36803 12700615 ~ 12700910 (+)
G32382 NA non-coding downstream 41152 12704964 ~ 12781485 (+)
G32414 NA non-coding downstream 145805 12809617 ~ 12810075 (+)
G32431 NA non-coding downstream 189150 12852962 ~ 12853804 (+)
G32439 NA non-coding downstream 238725 12902537 ~ 12952107 (+)
G31865 NA other upstream 468432 12192130 ~ 12197418 (+)
CI01000004_11666900_11667179 NA other upstream 995920 11666900 ~ 11667659 (+)
G31710 NA other upstream 1021179 11637251 ~ 11642400 (+)
G30797 NA other upstream 2165791 10497376 ~ 10497788 (+)
CI01000004_14036114_14036449 KIAA0040 other downstream 1359735 14035393 ~ 14039142 (+)
CI01000004_15091390_15096502 GA45B, GADD45B, GADD45BB other downstream 2427432 15091200 ~ 15097173 (+)
G34220 NA other downstream 3275545 15939357 ~ 15939950 (+)
G33815 NA other downstream 3399603 16063415 ~ 16066464 (+)
G34400 NA other downstream 4313516 16971995 ~ 17025976 (+)

Expression


G32350 Expression in PRJCA010000

Bar chart with 27 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 6.
End of interactive chart.

G32350 Expression in each Bioproject

Bar chart with 28 bars.
G32350 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 300.
End of interactive chart.

Co-expression Network