G32491



Basic Information


Item Value
gene id G32491
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000004
NCBI id null
chromosome length 17451736
location 12977970 ~ 12978178 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU36857
CCGGGGGCAGGGTTTATGTAAATTTTAGGGTTAGTGATGTCACCAACCCGGGAAGAAGCTCGTTGTAGTCTCTATCAGCCGTTTGTTGTAGTCCTTAAACAAAGAATTCTTTAAAAGAAAATATCTCCCTTTGCATTGAACTTTGAGTGTCGAAACTTTGCAGATGTTGTTTATGCTCAAACAGCAACATTACACACTAACTAAAGTTA

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU36857 True 209 lncRNA 0.39 1 12977970 12978178
Loading

Neighbor


gene id symbol gene type direction distance location
CI01000004_12810922_12817913 VWC2L.2 coding upstream 159423 12810572 ~ 12818547 (+)
CI01000004_12764916_12775989 SLC6A9 coding upstream 201798 12764916 ~ 12776172 (+)
CI01000004_12719753_12721562 KLF17 coding upstream 255937 12718416 ~ 12722033 (+)
CI01000004_12696326_12707951 NA coding upstream 269974 12694377 ~ 12707996 (+)
CI01000004_12646972_12652534 NA coding upstream 325400 12646838 ~ 12652570 (+)
CI01000004_12984968_12997831 KISS1R, KISS1RA, GPR54 coding downstream 6790 12984968 ~ 12998063 (+)
CI01000004_13043279_13051835 NA coding downstream 65059 13043237 ~ 13051964 (+)
CI01000004_13062721_13076100 KIF2C coding downstream 84543 13062721 ~ 13076228 (+)
CI01000004_13197104_13205895 KLHL20 coding downstream 218926 13197104 ~ 13206585 (+)
CI01000004_13211489_13233786 DARS2 coding downstream 233311 13211489 ~ 13234194 (+)
G32439 NA non-coding upstream 25863 12902537 ~ 12952107 (+)
G32431 NA non-coding upstream 124166 12852962 ~ 12853804 (+)
G32414 NA non-coding upstream 167895 12809617 ~ 12810075 (+)
G32382 NA non-coding upstream 196485 12704964 ~ 12781485 (+)
G32371 NA non-coding upstream 277060 12700615 ~ 12700910 (+)
G32494 NA non-coding downstream 4251 12982429 ~ 12982669 (+)
G32506 NA non-coding downstream 23269 13001447 ~ 13001761 (+)
G32513 NA non-coding downstream 34349 13012527 ~ 13012760 (+)
G32502 NA non-coding downstream 43156 13021334 ~ 13021822 (+)
G32538 NA non-coding downstream 54434 13032612 ~ 13032819 (+)
G31865 NA other upstream 782823 12192130 ~ 12197418 (+)
CI01000004_11666900_11667179 NA other upstream 1310311 11666900 ~ 11667659 (+)
G31710 NA other upstream 1335570 11637251 ~ 11642400 (+)
G30797 NA other upstream 2480182 10497376 ~ 10497788 (+)
CI01000004_14036114_14036449 KIAA0040 other downstream 1045369 14035393 ~ 14039142 (+)
CI01000004_15091390_15096502 GA45B, GADD45B, GADD45BB other downstream 2113066 15091200 ~ 15097173 (+)
G34220 NA other downstream 2961179 15939357 ~ 15939950 (+)
G33815 NA other downstream 3085237 16063415 ~ 16066464 (+)
G34400 NA other downstream 3999150 16971995 ~ 17025976 (+)

Expression


G32491 Expression in PRJCA010000

Bar chart with 27 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 2.
End of interactive chart.

G32491 Expression in each Bioproject

Bar chart with 20 bars.
G32491 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 200.
End of interactive chart.

Co-expression Network