G32594


Basic Information

Item Value
gene id G32594
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000004
NCBI id null
chromosome length 17451736
location 13192718 ~ 13193161 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU36969
AAGTAGCTAACATAGCATAATCAGATGCAGCTTTATTTTTTAGTAACAGTAATACAGCATTTTCTCCATCATACAATACGTTTTAAAATTAATTGCATGCCATTTATCAACACAAGCCATCCAGCATTTAATATGATATTCTAAAATCGATCTAGCTTACTGCAGTGTGCAACAAGTGTCTCACAGCAGCCGCCGAGCGAGTAACGTTATAACATCATTTTCAACACACTCAAATGTATCTAATATGATAAACAGAGCTGTGTTACCTCATACTCATGACCGGAAAAGCGGAAGTGGCGCCGATGACTGTGGCATAATAAAAGTTCCGCTGCTCGTGAGGCGTGTGTTGCGCAATCGCTCCAGCGGCCACAACACTCGGTCCTGCTCTGCTTCATACTACAATAATGTTAATAATCGCATCCATGAACATGATTTCTTCCCGAG

Function

NR:

description
PREDICTED: S phase cyclin A-associated protein in the endoplasmic reticulum-like isoform X6

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU36969 True 444 lncRNA 0.34 1 13192718 13193161

Neighbor

gene id symbol gene type direction distance location
CI01000004_13062721_13076100 KIF2C coding upstream 116490 13062721 ~ 13076228 (+)
CI01000004_13043279_13051835 NA coding upstream 140754 13043237 ~ 13051964 (+)
CI01000004_12984968_12997831 KISS1R, KISS1RA, GPR54 coding upstream 194655 12984968 ~ 12998063 (+)
CI01000004_12810922_12817913 VWC2L.2 coding upstream 374171 12810572 ~ 12818547 (+)
CI01000004_12764916_12775989 SLC6A9 coding upstream 416546 12764916 ~ 12776172 (+)
CI01000004_13197104_13205895 KLHL20 coding downstream 3943 13197104 ~ 13206585 (+)
CI01000004_13211489_13233786 DARS2 coding downstream 18328 13211489 ~ 13234194 (+)
CI01000004_13467845_13475703 NA coding downstream 274684 13467845 ~ 13476204 (+)
CI01000004_13512059_13706090 ASTN1 coding downstream 318898 13512059 ~ 13706090 (+)
CI01000004_13708254_13713625 NA coding downstream 514726 13707887 ~ 13714179 (+)
G32592 NA non-coding upstream 9752 13182696 ~ 13182966 (+)
G32591 NA non-coding upstream 14268 13178229 ~ 13178450 (+)
G32588 NA non-coding upstream 21043 13171348 ~ 13171675 (+)
G32515 NA non-coding upstream 27460 13145133 ~ 13165258 (+)
G32595 NA non-coding downstream 558 13193719 ~ 13194022 (+)
G32599 NA non-coding downstream 38426 13231587 ~ 13232951 (+)
G32894 NA non-coding downstream 63769 13256930 ~ 13257222 (+)
G32926 NA non-coding downstream 136153 13329314 ~ 13329550 (+)
G32927 NA non-coding downstream 138023 13331184 ~ 13331384 (+)
CI01000004_12646972_12652534 NA other upstream 537007 12646838 ~ 12652570 (+)
G31865 NA other upstream 997571 12192130 ~ 12197418 (+)
CI01000004_11666900_11667179 NA other upstream 1525059 11666900 ~ 11667659 (+)
G31710 NA other upstream 1550318 11637251 ~ 11642400 (+)
G30797 NA other upstream 2694930 10497376 ~ 10497788 (+)
CI01000004_14036114_14036449 KIAA0040 other downstream 830386 14035393 ~ 14039142 (+)
CI01000004_15091390_15096502 GA45B, GADD45B, GADD45BB other downstream 1898083 15091200 ~ 15097173 (+)
G34220 NA other downstream 2746196 15939357 ~ 15939950 (+)
G33815 NA other downstream 2870254 16063415 ~ 16066464 (+)
G34400 NA other downstream 3784167 16971995 ~ 17025976 (+)

Expression


Co-expression Network