G33758


Basic Information

Item Value
gene id G33758
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000004
NCBI id null
chromosome length 17451736
location 14588598 ~ 14589028 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU38265
TTACTTCAGGCATGCAGAGGTTTCAGAGATAGTTCAACATAGTTGTTCATTTTTTTCCCTGTCAGAAATGATATTCCTATTTTGTCTGTGTCTTATCTCCCTCTTAATAGGTGATGTCTCTAGTGAGGGAATAGCACCAGTCTCTCCTAATGAATTTGTCTCAGAAGGTAAAACAATCACCCTGTCCTGCAATTACAATGGATCAACTGCTACAGATGCTCTCCACTGGTATCGTCAGTACCCGAGATCCAGACCAGACTTCCTGTTTCTGGTTAATGAAGCTAAATTTAAGCAACCAGCTGAGCCTCCAATTC

Function

NR:

description
PREDICTED: ras-related protein Rab-2A

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU38265 True 314 lncRNA 0.35 2 14588598 14589028

Neighbor

gene id symbol gene type direction distance location
CI01000004_14574723_14575066 NA coding downstream 13532 14573281 ~ 14575066 (-)
CI01000004_14571792_14572305 NA coding downstream 16172 14571741 ~ 14572426 (-)
CI01000004_14569847_14571236 NA coding downstream 17102 14569806 ~ 14571496 (-)
CI01000004_14563131_14563558 NA coding downstream 24797 14562069 ~ 14563801 (-)
CI01000004_14557340_14560918 TRAC coding downstream 27556 14557281 ~ 14561042 (-)
CI01000004_14591958_14594875 NA coding upstream 2248 14591276 ~ 14594875 (-)
CI01000004_14597582_14610531 NA coding upstream 8335 14597363 ~ 14610531 (-)
CI01000004_14611052_14612588 NA coding upstream 22024 14611052 ~ 14612588 (-)
CI01000004_14612987_14614652 NA coding upstream 23959 14612987 ~ 14614652 (-)
CI01000004_14618502_14618962 NA coding upstream 29128 14618156 ~ 14619037 (-)
G33650 NA non-coding downstream 60971 14527408 ~ 14527627 (-)
G33648 NA non-coding downstream 62459 14525935 ~ 14526139 (-)
G33638 NA non-coding downstream 67020 14521367 ~ 14521578 (-)
G33633 NA non-coding downstream 89140 14497445 ~ 14499458 (-)
G34461 NA non-coding upstream 98409 14687437 ~ 14693318 (-)
G34479 NA non-coding upstream 117695 14706723 ~ 14707120 (-)
G33756 NA other downstream 2853 14585171 ~ 14585745 (-)
G33755 NA other downstream 6725 14581406 ~ 14581873 (-)
G33750 NA other downstream 9597 14578458 ~ 14579001 (-)
G33746 NA other downstream 19334 14568793 ~ 14569264 (-)
CI01000004_14543631_14551256 NA other downstream 37314 14541515 ~ 14551352 (-)
G33783 NA other upstream 48823 14637851 ~ 14638474 (-)
G34459 NA other upstream 83511 14672539 ~ 14673015 (-)
CI01000004_14676793_14679785 NA other upstream 90111 14676422 ~ 14679856 (-)

Expression


Co-expression Network