G34004


Basic Information

Item Value
gene id G34004
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000004
NCBI id null
chromosome length 17451736
location 15036017 ~ 15036233 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU38544
AAGACATTGTTAAAATAGTCCATGTGACTACAGTGGTTCAACCTTAATGTTATGAAGCGACGATAACTTTTTGTGCGCAAAAACAAAACATTTTTGGGTGAACTAACCCTTTAACATTAAAAACACAGAAGCAGAAATATTAGGCTGCTGTCACTTTAAGACATAATGCATGGATCCAACATACTGATACTGTACACATGCGTTGTCTTTCTCAACC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU38544 True 217 lncRNA 0.36 1 15036017 15036233

Neighbor

gene id symbol gene type direction distance location
CI01000004_15010164_15028433 NRD1A, NRDC coding upstream 7309 15010164 ~ 15028708 (+)
CI01000004_14934532_14938094 NA coding upstream 97923 14933874 ~ 14938094 (+)
CI01000004_14919607_14929407 GOLIM4B coding upstream 106610 14919475 ~ 14929407 (+)
CI01000004_14910312_14915166 NA coding upstream 120038 14910114 ~ 14915979 (+)
CI01000004_14889786_14894594 KLHL6 coding upstream 141095 14889786 ~ 14894922 (+)
CI01000004_15048166_15051524 NA coding downstream 11933 15048166 ~ 15052817 (+)
CI01000004_15056504_15062261 RABGAP1L2 coding downstream 19689 15055922 ~ 15063180 (+)
CI01000004_15091390_15096502 GA45B, GADD45B, GADD45BB coding downstream 54967 15091200 ~ 15097173 (+)
CI01000004_15110181_15110483 NA coding downstream 73365 15109598 ~ 15110625 (+)
CI01000004_15126731_15131774 NA coding downstream 90451 15126684 ~ 15132238 (+)
G33951 NA non-coding upstream 182575 14845345 ~ 14853442 (+)
G33924 NA non-coding upstream 227728 14768014 ~ 14808289 (+)
G33919 NA non-coding upstream 243902 14758132 ~ 14792115 (+)
G33662 NA non-coding upstream 500673 14535078 ~ 14535344 (+)
G33644 NA non-coding upstream 507236 14528530 ~ 14528781 (+)
G34009 NA non-coding downstream 9009 15045242 ~ 15045445 (+)
G34017 NA non-coding downstream 57872 15094105 ~ 15094375 (+)
G34027 NA non-coding downstream 67117 15103350 ~ 15103577 (+)
G34028 NA non-coding downstream 67733 15103966 ~ 15104168 (+)
G34031 NA non-coding downstream 70189 15106422 ~ 15106699 (+)
CI01000004_14036114_14036449 KIAA0040 other upstream 999117 14035393 ~ 14039142 (+)
CI01000004_12646972_12652534 NA other upstream 2380306 12646838 ~ 12652570 (+)
G31865 NA other upstream 2840870 12192130 ~ 12197418 (+)
CI01000004_11666900_11667179 NA other upstream 3368358 11666900 ~ 11667659 (+)
G31710 NA other upstream 3393617 11637251 ~ 11642400 (+)
G34220 NA other downstream 903124 15939357 ~ 15939950 (+)
G33815 NA other downstream 1027182 16063415 ~ 16066464 (+)
G34400 NA other downstream 1941095 16971995 ~ 17025976 (+)

Expression


Co-expression Network