G33896


Basic Information

Item Value
gene id G33896
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000004
NCBI id null
chromosome length 17451736
location 15223661 ~ 15223914 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU38421
TATTATTATCAATGTTGAAAACAATTTTTTTTCAGGATTATTTGATGAATAGAAGTTCAAAAGAACCGCATTTATATGAAATAAAAAGCTTTTTCAACATTATAAACAGTCTATGCTGTCACATTTGATCAATTTAATGGTGAATAAAAGTATTAATTTCTTAACAAAACAGTAGGGTATAATGTTACAAAAGCTTTATATTTCATATAAATGCTGTTCTTTTGAGCTTTCTATTAATCAAATAATCTTGAAAA

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU38421 True 254 lncRNA 0.23 1 15223661 15223914

Neighbor

gene id symbol gene type direction distance location
CI01000004_15200553_15209521 SLC1A8B coding upstream 13837 15198242 ~ 15209824 (+)
CI01000004_15126731_15131774 NA coding upstream 91423 15126684 ~ 15132238 (+)
CI01000004_15110181_15110483 NA coding upstream 113036 15109598 ~ 15110625 (+)
CI01000004_15091390_15096502 GA45B, GADD45B, GADD45BB coding upstream 126488 15091200 ~ 15097173 (+)
CI01000004_15056504_15062261 RABGAP1L2 coding upstream 160481 15055922 ~ 15063180 (+)
CI01000004_15229290_15233374 PEX19 coding downstream 4862 15228776 ~ 15234597 (+)
CI01000004_15237719_15253901 COPA coding downstream 13805 15237719 ~ 15254158 (+)
CI01000004_15260416_15262090 APODA.2 coding downstream 36325 15260239 ~ 15262240 (+)
CI01000004_15277204_15286845 SAMD7 coding downstream 53290 15277204 ~ 15286987 (+)
CI01000004_15291659_15296777 NA coding downstream 67745 15291659 ~ 15297847 (+)
G34032 NA non-coding upstream 63601 15106736 ~ 15160060 (+)
G34031 NA non-coding upstream 116962 15106422 ~ 15106699 (+)
G34028 NA non-coding upstream 119493 15103966 ~ 15104168 (+)
G34027 NA non-coding upstream 120084 15103350 ~ 15103577 (+)
G34017 NA non-coding upstream 129286 15094105 ~ 15094375 (+)
G34055 NA non-coding downstream 12216 15236130 ~ 15236383 (+)
G34061 NA non-coding downstream 47730 15271644 ~ 15271905 (+)
G33857 NA non-coding downstream 195347 15419261 ~ 15425806 (+)
G34090 NA non-coding downstream 209254 15433168 ~ 15433373 (+)
G34100 NA non-coding downstream 257349 15481263 ~ 15481530 (+)
CI01000004_14036114_14036449 KIAA0040 other upstream 1186761 14035393 ~ 14039142 (+)
CI01000004_12646972_12652534 NA other upstream 2567950 12646838 ~ 12652570 (+)
G31865 NA other upstream 3028514 12192130 ~ 12197418 (+)
CI01000004_11666900_11667179 NA other upstream 3556002 11666900 ~ 11667659 (+)
G34220 NA other downstream 715443 15939357 ~ 15939950 (+)
G33815 NA other downstream 839501 16063415 ~ 16066464 (+)
G34400 NA other downstream 1753414 16971995 ~ 17025976 (+)

Expression


Co-expression Network