G34181


Basic Information

Item Value
gene id G34181
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000004
NCBI id null
chromosome length 17451736
location 15748649 ~ 15748926 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU38742
CACCAGTTTCAGCGGTTTTCTGCTTTTTCCTCTGTGAGCGTCAACTGAATTCAGAATTGTGACAAAAAATGTTACTATTGTCATAATAATAATAATATATGTGTGATATTTACATCAAAGGAAGAGAACATTGTATGATACTAAACTCCTTTACATGATAGGTAAATATGAAATAATAATAATAATAATAATAAAGAAGTCTTTATTTTTTTTGTTGACTTTTTCTTCAGCTTTTTTTATTTCAAATGCAAATTAAAGGGGTAGTTCACCCAAAAATG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU38742 True 278 lncRNA 0.27 1 15748649 15748926

Neighbor

gene id symbol gene type direction distance location
CI01000004_15711867_15722470 PARP2 coding upstream 26067 15711867 ~ 15722582 (+)
CI01000004_15694735_15698103 SDR39U1 coding upstream 50228 15694735 ~ 15698421 (+)
CI01000004_15687242_15691238 NA coding upstream 57372 15685262 ~ 15691277 (+)
CI01000004_15645965_15650241 NA coding upstream 98375 15645965 ~ 15650274 (+)
CI01000004_15631508_15632389 NA coding upstream 116246 15631430 ~ 15632403 (+)
CI01000004_15787382_15803133 NA coding downstream 38456 15787382 ~ 15803144 (+)
CI01000004_15825817_15827475 TEP1 coding downstream 76891 15825817 ~ 15827603 (+)
CI01000004_15859240_15861471 APOL1 coding downstream 110314 15859240 ~ 15863449 (+)
CI01000004_15867404_15875293 NA coding downstream 118059 15866985 ~ 15875304 (+)
CI01000004_15892502_15900203 DCAF8 coding downstream 141447 15890373 ~ 15900852 (+)
G33803 NA non-coding upstream 37683 15622928 ~ 15710966 (+)
G33882 NA non-coding upstream 126329 15620079 ~ 15622320 (+)
G33834 NA non-coding upstream 154274 15586066 ~ 15594375 (+)
G34142 NA non-coding upstream 191865 15556405 ~ 15556784 (+)
G34141 NA non-coding upstream 192436 15555855 ~ 15556213 (+)
G34183 NA non-coding downstream 2737 15751663 ~ 15752548 (+)
G34186 NA non-coding downstream 7109 15756035 ~ 15756391 (+)
G34188 NA non-coding downstream 18826 15767752 ~ 15767991 (+)
G34192 NA non-coding downstream 27333 15776259 ~ 15776513 (+)
G34193 NA non-coding downstream 27864 15776790 ~ 15777008 (+)
CI01000004_15091390_15096502 GA45B, GADD45B, GADD45BB other upstream 656680 15091200 ~ 15097173 (+)
CI01000004_14036114_14036449 KIAA0040 other upstream 1711749 14035393 ~ 14039142 (+)
CI01000004_12646972_12652534 NA other upstream 3092938 12646838 ~ 12652570 (+)
G31865 NA other upstream 3553502 12192130 ~ 12197418 (+)
CI01000004_11666900_11667179 NA other upstream 4080990 11666900 ~ 11667659 (+)
G34220 NA other downstream 190431 15939357 ~ 15939950 (+)
G33815 NA other downstream 314489 16063415 ~ 16066464 (+)
G34400 NA other downstream 1228402 16971995 ~ 17025976 (+)

Expression


Co-expression Network