G34640



Basic Information


Item Value
gene id G34640
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000004
NCBI id null
chromosome length 17451736
location 15748649 ~ 15748929 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU39325
TTTCATTTTTGGGTGAACTACCCCTTTAATTTGCATTTGAAATAAAAAAAGCTGAAGAAAAAGTCAACAAAAAAAATAAAGACTTCTTTATTATTATTATTATTATTATTTCATATTTACCTATCATGTAAAGGAGTTTAGTATCATACAATGTTCTCTTCCTTTGATGTAAATATCACACATATATTATTATTATTATGACAATAGTAACATTTTTTGTCACAATTCTGAATTCAGTTGACGCTCACAGAGGAAAAAGCAGAAAACCGCTGAAACTGGTG

Function


GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA


RNA id representative length rna type GC content exon number start site end site
TU39325 True 281 lncRNA 0.27 1 15748649 15748929

Neighbor


gene id symbol gene type direction distance location
CI01000004_15726420_15733105 NA coding downstream 15544 15726052 ~ 15733105 (-)
CI01000004_15702447_15708692 METTL17 coding downstream 39957 15702371 ~ 15708692 (-)
CI01000004_15653837_15673610 NFATC4 coding downstream 75039 15653725 ~ 15673610 (-)
CI01000004_15581505_15586825 NA coding downstream 161824 15581390 ~ 15586825 (-)
CI01000004_15561061_15573201 HIAT1A, MFSD14A coding downstream 175448 15559909 ~ 15573201 (-)
CI01000004_15751774_15753519 NA coding upstream 2804 15751733 ~ 15755397 (-)
CI01000004_15760841_15761919 HBL4 coding upstream 11861 15760790 ~ 15761987 (-)
CI01000004_15827737_15828938 NA coding upstream 78739 15827668 ~ 15828960 (-)
CI01000004_15832789_15836192 NA coding upstream 83655 15832573 ~ 15836231 (-)
CI01000004_15836936_15841048 NA coding upstream 87533 15836462 ~ 15841829 (-)
G34595 NA non-coding downstream 47873 15697005 ~ 15700776 (-)
G34613 NA non-coding downstream 54360 15693090 ~ 15694289 (-)
G34768 NA non-coding downstream 66132 15676572 ~ 15682517 (-)
G34734 NA non-coding downstream 349872 15398571 ~ 15398777 (-)
G34733 NA non-coding downstream 350641 15397806 ~ 15398008 (-)
G34608 NA non-coding upstream 14313 15763242 ~ 15765773 (-)
G34776 NA non-coding upstream 18380 15767309 ~ 15768270 (-)
G34778 NA non-coding upstream 23230 15772159 ~ 15772396 (-)
G34620 NA non-coding upstream 30747 15779676 ~ 15780614 (-)
G34779 NA non-coding upstream 47081 15796010 ~ 15796390 (-)
G34718 NA other downstream 467000 15281016 ~ 15281649 (-)
CI01000004_15086759_15087492 NA other downstream 658291 15086671 ~ 15087575 (-)
G34668 NA other downstream 695874 15051176 ~ 15052775 (-)
G34632 NA other downstream 723428 15011361 ~ 15025221 (-)
CI01000004_14827536_14831360 NA other downstream 920526 14827496 ~ 14831526 (-)
G34633 NA other upstream 38457 15787386 ~ 15787897 (-)
G34796 NA other upstream 111684 15860613 ~ 15863748 (-)
G34934 NA other upstream 652816 16401745 ~ 16421506 (-)
G34982 NA other upstream 753796 16502725 ~ 16515974 (-)

Expression



Co-expression Network