G34205


Basic Information

Item Value
gene id G34205
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000004
NCBI id null
chromosome length 17451736
location 15843132 ~ 15843402 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU38769
TTCTAGCTTAACTTAAGCAAAAGCTGATTTATAGTTACTGATAAAGTTGTATTTCTCATAAATGAAATGATAGAAGTTATTCATAGTTATAGAGATTATTCTTCTTTCCATAACTTTGGTAACAGAGGTGATGAATGCGGTCAACACTGTACATTACAGAGGAAATATTACCGCTTTGGTCATAAGTGACAGTGTGAGGCTGAAATAACCCCAGATACTTTGATCTTCTGAGATATGGACAATACAAACACACACAGGCATCTGTTTTCAC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU38769 True 271 lncRNA 0.34 1 15843132 15843402

Neighbor

gene id symbol gene type direction distance location
CI01000004_15825817_15827475 TEP1 coding upstream 15529 15825817 ~ 15827603 (+)
CI01000004_15787382_15803133 NA coding upstream 39988 15787382 ~ 15803144 (+)
CI01000004_15711867_15722470 PARP2 coding upstream 120550 15711867 ~ 15722582 (+)
CI01000004_15694735_15698103 SDR39U1 coding upstream 144711 15694735 ~ 15698421 (+)
CI01000004_15687242_15691238 NA coding upstream 151855 15685262 ~ 15691277 (+)
CI01000004_15859240_15861471 APOL1 coding downstream 15838 15859240 ~ 15863449 (+)
CI01000004_15867404_15875293 NA coding downstream 23583 15866985 ~ 15875304 (+)
CI01000004_15892502_15900203 DCAF8 coding downstream 46971 15890373 ~ 15900852 (+)
CI01000004_15906907_15909647 HNRNPC coding downstream 63505 15906907 ~ 15909669 (+)
CI01000004_15930478_15944692 NA coding downstream 87076 15930478 ~ 15944744 (+)
G34196 NA non-coding upstream 62508 15779675 ~ 15780624 (+)
G34195 NA non-coding upstream 63634 15779166 ~ 15779498 (+)
G34194 NA non-coding upstream 65781 15777033 ~ 15777351 (+)
G34193 NA non-coding upstream 66124 15776790 ~ 15777008 (+)
G34192 NA non-coding upstream 66619 15776259 ~ 15776513 (+)
G34213 NA non-coding downstream 43876 15887278 ~ 15887534 (+)
G34214 NA non-coding downstream 77281 15920683 ~ 15920886 (+)
G34215 NA non-coding downstream 80302 15923704 ~ 15924496 (+)
G34216 NA non-coding downstream 85099 15928501 ~ 15928750 (+)
G34228 NA non-coding downstream 171504 16014906 ~ 16015106 (+)
CI01000004_15091390_15096502 GA45B, GADD45B, GADD45BB other upstream 751163 15091200 ~ 15097173 (+)
CI01000004_14036114_14036449 KIAA0040 other upstream 1806232 14035393 ~ 14039142 (+)
CI01000004_12646972_12652534 NA other upstream 3187421 12646838 ~ 12652570 (+)
G31865 NA other upstream 3647985 12192130 ~ 12197418 (+)
CI01000004_11666900_11667179 NA other upstream 4175473 11666900 ~ 11667659 (+)
G34220 NA other downstream 95955 15939357 ~ 15939950 (+)
G33815 NA other downstream 220013 16063415 ~ 16066464 (+)
G34400 NA other downstream 1133926 16971995 ~ 17025976 (+)

Expression


Co-expression Network