G34830


Basic Information

Item Value
gene id G34830
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000004
NCBI id null
chromosome length 17451736
location 15998819 ~ 15999147 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU39538
TAAAACTTTATAAATTCAAATAACTAGCTTCTGGCAGATGACCGTACACATACTGCGCACTTCAATTGGGTAAGAGCAACCTTTGACCTGACGCGATGACGAACGCAGAGGCGAGAGCAAAACAAAACACTGGTCACGAATTAGAAGTTTCGATATGTAAGAGAAGAGGAGCTTAAATTTGTTGCCCAGCCATATTTGTTGAACCGCGAGAGGCGTCTAAGCTTACGATCCTGCGTCATACATCGCGTCAGAGGATTACTCATTCTCCGTGCGGCCGTTCACCGGAAGCTAGTTGTTTGAATATATAAAGTTTTAAATACGGATATTTT

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU39538 True 329 lncRNA 0.43 1 15998819 15999147

Neighbor

gene id symbol gene type direction distance location
CI01000004_15991836_15995032 CBLN12, CBLN3, CBLN1 coding downstream 3635 15991640 ~ 15995184 (-)
CI01000004_15965178_15990162 CHD8 coding downstream 8644 15965120 ~ 15990175 (-)
CI01000004_15956601_15962195 TOX4 coding downstream 35889 15956000 ~ 15962930 (-)
CI01000004_15922924_15923872 NA coding downstream 74947 15922726 ~ 15923872 (-)
CI01000004_15911104_15915972 NA coding downstream 82800 15910936 ~ 15916019 (-)
CI01000004_15999644_16005705 NA coding upstream 348 15999495 ~ 16006425 (-)
CI01000004_16079875_16086958 ACIN1, ACIN1A coding upstream 80728 16079875 ~ 16087211 (-)
CI01000004_16092821_16115520 NA coding upstream 93559 16092706 ~ 16115530 (-)
CI01000004_16146406_16149756 NA coding upstream 146929 16146076 ~ 16149756 (-)
CI01000004_16152238_16154327 NA coding upstream 152586 16151733 ~ 16154327 (-)
G34583 NA non-coding downstream 54155 15930375 ~ 15944664 (-)
G34814 NA non-coding downstream 70069 15928443 ~ 15928750 (-)
G34811 NA non-coding downstream 72558 15926010 ~ 15926261 (-)
G34616 NA non-coding downstream 88148 15906913 ~ 15910671 (-)
G34801 NA non-coding downstream 111406 15887137 ~ 15887413 (-)
G34836 NA non-coding upstream 20411 16019558 ~ 16023123 (-)
G34837 NA non-coding upstream 24097 16023244 ~ 16024781 (-)
G34639 NA non-coding upstream 124413 16123560 ~ 16136696 (-)
G34866 NA non-coding upstream 234164 16233311 ~ 16233711 (-)
G34796 NA other downstream 135071 15860613 ~ 15863748 (-)
CI01000004_15832789_15836192 NA other downstream 162588 15832573 ~ 15836231 (-)
G34633 NA other downstream 210922 15787386 ~ 15787897 (-)
G34718 NA other downstream 717170 15281016 ~ 15281649 (-)
CI01000004_15086759_15087492 NA other downstream 908461 15086671 ~ 15087575 (-)
G34934 NA other upstream 402598 16401745 ~ 16421506 (-)
G34982 NA other upstream 503578 16502725 ~ 16515974 (-)
G34995 NA other upstream 530295 16529442 ~ 16533008 (-)
G34999 NA other upstream 538048 16537195 ~ 16541278 (-)
CI01000004_16596848_16599652 NA other upstream 579520 16596476 ~ 16601205 (-)

Expression


Co-expression Network