G34361


Basic Information

Item Value
gene id G34361
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000004
NCBI id null
chromosome length 17451736
location 16673921 ~ 16674301 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU38944
ATGCAAGTTTATGCTGGATTTAGTTCATAAATCATATTGTTTACACATTAGATGCTTTGCAGTTGTTATATAGGTGTTAAATATTGCAGTTTGGATGTTTTCATTGAGATTATAATGGATGGGTTTACAAAAGTTTATAAAATTGACAGGATATCTTTACTTGGGGCATTTGAAAAACAAAGCTTGCCTATTTCCAAATGTAATCGCGTGCATCTCTGATGATTATATTGCCCAATTATATTATATTATATTATATTATATTATATTACAACTGCAAAACGTCCAATGTGTAAACAATGATTTACACTAAATCCAGCATCCACTAAAATCCACATAAATCCACTAAAACCTGCATATTTTTAACGCTCAAGACAGACGTCA

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU38944 True 381 lncRNA 0.30 1 16673921 16674301

Neighbor

gene id symbol gene type direction distance location
CI01000004_16649360_16654303 NA coding upstream 19568 16649171 ~ 16654353 (+)
CI01000004_16579927_16586961 NA coding upstream 86724 16579927 ~ 16587197 (+)
CI01000004_16567132_16570668 NA coding upstream 102553 16567132 ~ 16571368 (+)
CI01000004_16490931_16555397 CARMIL3, LRRC16B coding upstream 117928 16490931 ~ 16555993 (+)
CI01000004_16467711_16471121 NA coding upstream 202414 16467711 ~ 16471507 (+)
CI01000004_16695941_16729500 NA coding downstream 21332 16695633 ~ 16729719 (+)
CI01000004_16812706_16814956 NA coding downstream 138405 16812706 ~ 16815068 (+)
CI01000004_16869205_16944944 CLSTN2 coding downstream 194904 16869205 ~ 16944944 (+)
CI01000004_17062704_17110319 CRHR2.S, CRHR2 coding downstream 388403 17062704 ~ 17110319 (+)
CI01000004_17214619_17236647 PTH1R, PTH1RA coding downstream 540318 17214619 ~ 17236674 (+)
G34359 NA non-coding upstream 1154 16672544 ~ 16672767 (+)
G34357 NA non-coding upstream 1487 16665580 ~ 16672434 (+)
G34277 NA non-coding upstream 27699 16641342 ~ 16646222 (+)
G34330 NA non-coding upstream 201688 16472007 ~ 16472233 (+)
G34323 NA non-coding upstream 218295 16449680 ~ 16455626 (+)
G34362 NA non-coding downstream 204 16674505 ~ 16674814 (+)
G34391 NA non-coding downstream 254173 16928474 ~ 16956174 (+)
G34399 NA non-coding downstream 276570 16950871 ~ 16952619 (+)
G34400 NA non-coding downstream 297694 16971995 ~ 17025976 (+)
G34427 NA non-coding downstream 377262 17051563 ~ 17052535 (+)
G33815 NA other upstream 607457 16063415 ~ 16066464 (+)
G34220 NA other upstream 733971 15939357 ~ 15939950 (+)
CI01000004_15091390_15096502 GA45B, GADD45B, GADD45BB other upstream 1581952 15091200 ~ 15097173 (+)
CI01000004_14036114_14036449 KIAA0040 other upstream 2637021 14035393 ~ 14039142 (+)
CI01000004_12646972_12652534 NA other upstream 4018210 12646838 ~ 12652570 (+)

Expression


Co-expression Network