CI01000006_04776793_04779651 (IGSF9BB, IGSF9B)


Basic Information

Item Value
gene id CI01000006_04776793_04779651
gene name IGSF9BB, IGSF9B
gene type coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000006
NCBI id null
chromosome length 13024002
location 4776793 ~ 4779687 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>CI01000006_04776793_04779651.mRNA
GCACCTCTTAAGGAAGCTCTCACACTCTTACATACGCTGATTATACCAGTTTTTCATTGGCCAGTGACCTTAAGTCAAGGTGCCCACGGAGTCAGAGAGGAGCCCCAGTTTGTGACGGCCCGCGCTGGGGAGACCGTGATTCTGGGATGTGACGTGACCCACCCACTCAACGGCCAGCCCTACGTGGTGGAGTGGTTCAAGTTTGGAGTTCCCATCCCCTTCTTCATCAACTTCCGCTTCTACCCTCCCCATGTGGACCCCGAGTACGCCGGTGAGCCCTGATTATTTCTCTCTCACTGCATTTCATCATTCATACAA

Function

symbol description
igsf9b Predicted to enable cell adhesion molecule binding activity. Predicted to be involved in cell-cell adhesion. Predicted to be located in membrane. Predicted to be integral component of membrane. Predicted to be active in cell-cell junction. Predicted to be integral component of plasma membrane. Is expressed in nervous system; optic vesicle; otic vesicle; and somite. Orthologous to human IGSF9 (immunoglobulin superfamily member 9).
igsf9bb Predicted to be located in membrane. Predicted to be integral component of membrane. Predicted to be active in neuron projection. Orthologous to human IGSF9B (immunoglobulin superfamily member 9B).

GO:

id name namespace
GO:0016021 integral component of membrane cellular_component

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
CI01000006_04776793_04779651.mRNA True 318 mRNA 0.53 2 4776793 4779687

Neighbor

gene id symbol gene type direction distance location
CI01000006_04703916_04717922 NA coding upstream 58670 4702871 ~ 4718123 (+)
CI01000006_04538991_04543506 RFC2 coding upstream 233189 4538991 ~ 4543604 (+)
CI01000006_04509718_04523326 NFRKB coding upstream 253053 4509718 ~ 4523740 (+)
CI01000006_04493236_04507301 ST14B coding upstream 268595 4493236 ~ 4508198 (+)
CI01000006_04467086_04477770 PPME1 coding upstream 298860 4467086 ~ 4477933 (+)
CI01000006_04786488_04866122 IGSF9BB, IGSF9B coding downstream 6738 4786425 ~ 4866504 (+)
CI01000006_04931074_04985139 ARHGAP32, ARHGAP32B coding downstream 151387 4931074 ~ 4986173 (+)
CI01000006_04989318_04992332 SC5D coding downstream 209631 4989318 ~ 4992841 (+)
CI01000006_05169144_05174432 NA coding downstream 388430 5168117 ~ 5175303 (+)
CI01000006_05196006_05199842 NA coding downstream 415645 5195332 ~ 5200579 (+)
G41970 NA non-coding upstream 75614 4700924 ~ 4701179 (+)
G41969 NA non-coding upstream 81080 4695206 ~ 4695713 (+)
G41965 NA non-coding upstream 89526 4687044 ~ 4687267 (+)
G41885 NA non-coding upstream 142592 4632573 ~ 4634201 (+)
G42002 NA non-coding downstream 189968 4969655 ~ 5039311 (+)
G42181 NA non-coding downstream 532345 5312032 ~ 5312639 (+)
G42183 NA non-coding downstream 535016 5314703 ~ 5314958 (+)
G42197 NA non-coding downstream 560034 5339721 ~ 5339921 (+)
G42217 NA non-coding downstream 612246 5391933 ~ 5392138 (+)
CI01000006_03734862_03735227 BANF1, BANF1.S, BANF1.L other upstream 1040815 3734554 ~ 3736035 (+)
G41591 NA other upstream 1937372 2836167 ~ 2839421 (+)
G41424 NA other upstream 2116223 2645662 ~ 2660570 (+)
G41170 NA other upstream 3080972 1692065 ~ 1695821 (+)
G40768 NA other upstream 4283767 488407 ~ 493026 (+)
G41996 NA other downstream 337519 5117206 ~ 5124149 (+)
G43896 NA other downstream 990402 5770089 ~ 5771775 (+)
CI01000006_06104927_06109730 NA other downstream 1328797 6104927 ~ 6109820 (+)
CI01000006_06122278_06122736 NA other downstream 1342348 6122035 ~ 6122751 (+)
CI01000006_07167131_07168925 NA other downstream 2387102 7166778 ~ 7168925 (+)

Expression


Co-expression Network