G40811


Basic Information

Item Value
gene id G40811
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000006
NCBI id null
chromosome length 13024002
location 353720 ~ 353963 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU46313
AAACAATGGTAAATGGCGAATTCCCATGTGTGAAATTCAGTCATTTCAATATGAATCCATGTAAGTTGGAGTGATGTGACCATACCATTGTTTGGCAAATTTTCAATGGCAAAATTCAGTCATTTCAAAGGACACTTTTCACAGACTATTACTGTCAACATTGCAAATCTAGTAAAGTCATCTTTTTCTGTTCTGACCGCTGTAATCAGTCTATCTATATTTTTTCCCCTCTTTTGGAAAGTTG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU46313 True 244 lncRNA 0.35 1 353720 353963

Neighbor

gene id symbol gene type direction distance location
CI01000006_00315992_00319208 NA coding upstream 34334 315062 ~ 319386 (+)
CI01000006_00297085_00312816 CORO6 coding upstream 40665 297085 ~ 313055 (+)
CI01000006_00278488_00290221 SSH2B coding upstream 62016 278488 ~ 291704 (+)
CI01000006_00158417_00184263 OR115-7, OR115-2, OR115-9 coding upstream 169384 158357 ~ 184336 (+)
CI01000006_00143205_00144149 NA coding upstream 209178 142765 ~ 144542 (+)
CI01000006_00363989_00372189 NA coding downstream 10026 363989 ~ 372264 (+)
CI01000006_00418370_00420217 SPAG16 coding downstream 64407 418370 ~ 420317 (+)
CI01000006_00423835_00428157 NA coding downstream 69130 423093 ~ 428369 (+)
CI01000006_00502041_00503898 NA coding downstream 148078 502041 ~ 504306 (+)
CI01000006_00537552_00548276 NA coding downstream 183489 537452 ~ 548591 (+)
G40800 NA non-coding upstream 48454 305007 ~ 305266 (+)
G40799 NA non-coding upstream 50493 303015 ~ 303227 (+)
G40797 NA non-coding upstream 54528 298960 ~ 299192 (+)
G40796 NA non-coding upstream 54994 298411 ~ 298726 (+)
G40775 NA non-coding upstream 120441 229191 ~ 233279 (+)
G40767 NA non-coding downstream 6046 360009 ~ 484185 (+)
G40768 NA non-coding downstream 134444 488407 ~ 493026 (+)
G40852 NA non-coding downstream 175165 529128 ~ 551356 (+)
G40904 NA non-coding downstream 272770 626733 ~ 630432 (+)
CI01000006_00666971_00667988 NA non-coding downstream 303739 666793 ~ 668405 (+)
G40772 NA other downstream 121502 475465 ~ 479194 (+)
G41170 NA other downstream 1338102 1692065 ~ 1695821 (+)
G41424 NA other downstream 2291699 2645662 ~ 2660570 (+)

Expression


Co-expression Network