G139435 (slc6a9,LOC107739827)


Basic Information

Item Value
gene id G139435
gene name slc6a9,LOC107739827
gene type non-coding
species mexican tetra (Astyanax mexicanus)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_035912.1
NCBI id CM008315.1
chromosome length 41032606
location 5545244 ~ 5552062 (-)
genome version Astyanax_mexicanus-2.0_2017_mexican_tetra_Genome

Sequence

>TU188769
CTAGGATTTTCTGCCACTGTGGGGTGAGGTAGTATTTAATTCCGCTGATGGCTCCCTCCAGCGTGATTCCTCTGATGAACAGAATGGTCAGCACCACGTACGGGAAGGTCGCTGTAAAGTACACCACCTTGCCTGAAGATTTCACACCACGGATGAGGCAGAGGAAGACCACCACCCAGGAGATCGCCAGACAGCCCAGGATGGGGAGTCGCACCTCACCAAAGTTCCCAATGCCATCTGAGATATTCAGTACATAGTTCCTCCAGTATTCTTCACTCGGGCTCGTCCTTTTGGTGCGGTTGACCACCTCAGTGACCCCCGACACTACAGCTGAGATATTGGCGATGGAGGCATTAAGCCTCTGGGAGCCCACCACCCCGCTGCAGTCGGGCGTGTTCCAGGGGTTGTTGCAGTACGTCCAGGGCAGCAGGTTGGTCATAGACATGAAGAAGTAGTAGAAGGCGATGCAGATCACCACGTTATAGTAGATGCCGATATAGGTGGATACTACCATCATCC

Function

symbol description
slc6a9 Enables glycine transmembrane transporter activity. Acts upstream of or within several processes, including glycine transport; inhibitory postsynaptic potential; and regulation of glycinergic synaptic transmission. Predicted to be located in membrane. Predicted to be integral component of membrane. Predicted to be integral component of plasma membrane. Is expressed in fourth ventricle; hindbrain; neural rod; optic tectum; and spinal cord. Orthologous to human SLC6A9 (solute carrier family 6 member 9).

NR:

description
PREDICTED: sodium- and chloride-dependent glycine transporter 1 isoform X1

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU188769 True 519 lncRNA 0.53 3 5545244 5552062

Neighbor

gene id symbol gene type direction distance location
LOC103027706 acvr1l,LOC108428902,LOC108267867,LOC107678695,LOC107602619,LOC107749086,LOC107721710 coding downstream 500235 5031419 ~ 5045009 (-)
LOC103027391 crlf1a,crlf1,LOC108428895,LOC107602622,LOC107678692,LOC107588877,LOC107690059 coding downstream 739577 4771793 ~ 4805667 (-)
LOC103039917 LOC103039917,LOC108428861,LOC107602632,LOC107749223,LOC108267126,LOC107721708,LOC107588920 coding downstream 777951 4761753 ~ 4767293 (-)
LOC103039099 wdr48,LOC103039099,LOC108428893,LOC108268031 coding downstream 796491 4738988 ~ 4748753 (-)
LOC103038044 coa1,LOC103038044,LOC108428892,LOC108267121,LOC107600219 coding downstream 817716 4723386 ~ 4727528 (-)
ccdc24 NA coding upstream 15122 5567184 ~ 5598775 (-)
b4galt2 b4galt2,LOC107700994,LOC107557142,LOC107599894,LOC107657457 coding upstream 72797 5624859 ~ 5898800 (-)
LOC103034342 NA coding upstream 425205 5977267 ~ 5997977 (-)
LOC111194226 NA coding upstream 469036 6021098 ~ 6022596 (-)
LOC103029970 NA coding upstream 650746 6202808 ~ 6205849 (-)
G139155 NA non-coding downstream 89222 5455746 ~ 5456022 (-)
G139150 NA non-coding downstream 102338 5442556 ~ 5442906 (-)
G139149 LOC108415780 non-coding downstream 102817 5441786 ~ 5442427 (-)
G139110 NA non-coding downstream 199210 5344829 ~ 5346034 (-)
G139108 NA non-coding downstream 202430 5342481 ~ 5342814 (-)
G139443 NA non-coding upstream 21075 5573137 ~ 5744889 (-)
G139451 NA non-coding upstream 62727 5614789 ~ 5616029 (-)
G139457 NA non-coding upstream 119286 5671348 ~ 5671588 (-)
G139472 NA non-coding upstream 245429 5797491 ~ 5799470 (-)
G139488 atp6v0b,LOC102788333 non-coding upstream 353634 5905696 ~ 5927854 (-)
G139105 NA other downstream 214439 5330078 ~ 5330805 (-)
G139074 NA other downstream 268776 5276106 ~ 5276468 (-)
LOC103034146 zgc:110366,LOC108267892,LOC108437513,LOC105007548 other downstream 1207047 4330871 ~ 4338197 (-)
LOC103047802 pcolce2a,LOC108437522,LOC108268019 other downstream 1683888 3847722 ~ 3861356 (-)
G138708 NA other downstream 1711574 3832721 ~ 3833670 (-)
G139489 NA other upstream 456991 6009053 ~ 6010867 (-)
LOC111194281 NA other upstream 470547 6022609 ~ 6054733 (-)
G139487 NA other upstream 752907 6304969 ~ 6374709 (-)
G139587 NA other upstream 865323 6417385 ~ 6430319 (-)
lamc1 lamc1,LOC107658363,LOC107563558,LOC107678923,LOC107557259,LOC107722047,LOC106599430 other upstream 1012841 6564903 ~ 6689723 (-)

Expression


Co-expression Network