G142091 (abcf3)


Basic Information

Item Value
gene id G142091
gene name abcf3
gene type non-coding
species mexican tetra (Astyanax mexicanus)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_035912.1
NCBI id CM008315.1
chromosome length 41032606
location 17048450 ~ 17049952 (+)
genome version Astyanax_mexicanus-2.0_2017_mexican_tetra_Genome

Sequence

>TU192432
TTGAAGGTATTCAATGACTTTGCAAGCGCTTCGATCGTTTCCATATCCAGGTGATTGGTCGGCTCGTCAAGGATGTAAAAGTTAGGGCAAGGCATGGTCATCTGGGCAAAAGCCACACGGCTTTTCTGTCCTCCTGAAAGGCTTGCTACCGGTCGGGTTGCCAACTCCCCACTAATTCCATATCTACCAAGTTGACGTCTGTATTCTTCCTCCGTCAAACCAGGAAACTTGCTAAGCAGCAGCTCCACCGAACAAACATTGAGGTCCAGCTGGTCTACATGGTGCTGGCTAAAATAGCCAATCTTCAGGTTTCTGTTGGAAAATGAGCAAAAGGTCAGAACAAAAACTCAATTTCCC

Function

symbol description
abcf3 Predicted to enable ATP binding activity. Orthologous to human ABCF3 (ATP binding cassette subfamily F member 3).

NR:

description
ATP-binding cassette sub-family F member 3

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU192432 True 357 lncRNA 0.47 3 17048450 17049952

Neighbor

gene id symbol gene type direction distance location
rpe65 rpe65,rpe65a,LOC108436856,LOC107705134,LOC107708597,LOC107693590 coding upstream 43646 16994339 ~ 17004804 (+)
efcab14 efcab14,LOC106569140 coding upstream 108082 16927428 ~ 16940368 (+)
LOC103044680 NA coding upstream 1548945 15481787 ~ 15499505 (+)
LOC103044992 kcnj10,LOC108440277,LOC107703868,LOC107728032,LOC107692845,LOC102205965 coding upstream 1572235 15443821 ~ 15476215 (+)
trnae-uuc_20 NA coding upstream 1634603 15413776 ~ 15413847 (+)
LOC111194332 NA coding downstream 185247 17235199 ~ 17304091 (+)
LOC103034870 NA coding downstream 1703855 18753807 ~ 18785358 (+)
LOC103034112 LOC103034112,LOC108411205,LOC108267323,LOC106599750,LOC105019307,LOC103396312,LOC101066292 coding downstream 1744951 18794903 ~ 18816397 (+)
exosc4 exosc4,exos4 coding downstream 1771466 18821418 ~ 18826143 (+)
LOC111188235 NA coding downstream 1880927 18930879 ~ 18932145 (+)
G142082 NA non-coding upstream 33616 17013101 ~ 17014834 (+)
G142072 NA non-coding upstream 84936 16963192 ~ 16963514 (+)
G142065 NA non-coding upstream 150143 16897864 ~ 16898307 (+)
G142060 NA non-coding upstream 162043 16885916 ~ 16886407 (+)
G142047 NA non-coding upstream 232763 16815486 ~ 16815687 (+)
G142119 NA non-coding downstream 94690 17144642 ~ 17145074 (+)
G142168 NA non-coding downstream 156507 17206459 ~ 17208182 (+)
G142222 NA non-coding downstream 947222 17997174 ~ 18001176 (+)
G142220 NA non-coding downstream 972294 18022246 ~ 18024672 (+)
G142228 ss18 non-coding downstream 985836 18035788 ~ 18037584 (+)
G142067 LOC108436873,LOC108267642,LOC105898987 other upstream 63155 16972202 ~ 16985295 (+)
LOC103022185 ankrd13c,LOC108436872,LOC105898977 other upstream 80500 16948382 ~ 16967950 (+)
G141754 pnp5a,LOC108440276,LOC103368940,LOC107747996,LOC107692836,LOC107728028,LOC108267282,LOC107570765,LOC107703870 other upstream 1646546 15385616 ~ 15401904 (+)
G141791 NA other upstream 1762993 15228710 ~ 15285457 (+)
G141740 LOC108440267 other upstream 1991477 15054657 ~ 15056973 (+)
G142093 abcf3 other downstream 8342 17058294 ~ 17073484 (+)
G142166 LOC108436878 other downstream 153270 17203222 ~ 17204493 (+)
G142378 gpaa1 other downstream 1806284 18856236 ~ 18893509 (+)
G142384 gpaa1,LOC102780288 other downstream 1815498 18865450 ~ 18870317 (+)
G142620 NA other downstream 2686354 19736306 ~ 19868292 (+)

Expression


Co-expression Network