G41488


Basic Information

Item Value
gene id G41488
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000006
NCBI id null
chromosome length 13024002
location 2700607 ~ 2700826 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU47097
GTCCGTGTCATGGAGGGAAATCGTCAAAGCTCACTTCCTGTTTGCTTTGCTTTAACCTACAAAATATCATATGTGCCATGTCCACAGTCAGACCTGAAACAGTAAAAACAGAACAGCTCTTATAGTGTTTCTGTAACAGCGGTGGATTATAATAAAGCCTGGAAGACACAAAGATTCGCTTTACCCATTCTTAGGCTCTGTTCCAAATGCTGCCTTAAGC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU47097 True 220 lncRNA 0.42 1 2700607 2700826

Neighbor

gene id symbol gene type direction distance location
CI01000006_02665949_02677083 RASGRP2 coding upstream 23392 2665949 ~ 2677215 (+)
CI01000006_02616480_02616828 NA coding upstream 83768 2616480 ~ 2616839 (+)
CI01000006_02613864_02614742 NA coding upstream 85847 2613754 ~ 2614760 (+)
CI01000006_02531899_02588907 NRG2A coding upstream 110844 2531816 ~ 2589763 (+)
CI01000006_02490349_02491048 NA coding upstream 209489 2490349 ~ 2491118 (+)
CI01000006_02774064_02933983 NRXN2A coding downstream 73238 2774064 ~ 2933983 (+)
CI01000006_03016090_03016706 NA coding downstream 314311 3015137 ~ 3017314 (+)
CI01000006_03102358_03152576 NRXN2A coding downstream 401532 3102358 ~ 3152869 (+)
CI01000006_03164803_03183473 PCNX3 coding downstream 463363 3164189 ~ 3183719 (+)
CI01000006_03232003_03242938 NA coding downstream 531177 3232003 ~ 3243362 (+)
G41433 NA non-coding upstream 56222 2634103 ~ 2644385 (+)
G41482 NA non-coding upstream 67777 2632214 ~ 2632830 (+)
G41423 NA non-coding upstream 74421 2610231 ~ 2626186 (+)
G41461 NA non-coding upstream 254673 2445724 ~ 2445934 (+)
G41457 NA non-coding upstream 257631 2442612 ~ 2442976 (+)
G41494 NA non-coding downstream 8700 2709526 ~ 2710015 (+)
G41570 NA non-coding downstream 36310 2737136 ~ 2744797 (+)
G41547 NA non-coding downstream 275868 2976694 ~ 3053920 (+)
G41554 NA non-coding downstream 294944 2995770 ~ 3006315 (+)
G41538 NA non-coding downstream 321272 3022098 ~ 3032710 (+)
G41424 NA other upstream 40037 2645662 ~ 2660570 (+)
G41170 NA other upstream 1004786 1692065 ~ 1695821 (+)
G40768 NA other upstream 2207581 488407 ~ 493026 (+)
G40767 NA other upstream 2217272 360009 ~ 484185 (+)
G40772 NA other upstream 2221413 475465 ~ 479194 (+)
G41591 NA other downstream 135341 2836167 ~ 2839421 (+)
CI01000006_03734862_03735227 BANF1, BANF1.S, BANF1.L other downstream 1028404 3734554 ~ 3736035 (+)
G41996 NA other downstream 2416380 5117206 ~ 5124149 (+)
G43896 NA other downstream 3069263 5770089 ~ 5771775 (+)
CI01000006_06104927_06109730 NA other downstream 3407658 6104927 ~ 6109820 (+)

Expression


Co-expression Network