G41606


Basic Information

Item Value
gene id G41606
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000006
NCBI id null
chromosome length 13024002
location 3198562 ~ 3198765 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU47230
AATATTCTAATTTTCTGAGATACTGAATTTGGGATTTTCCTTAGTTGTCAGTTATAATCATCAAAATTAAAAGAAATAAACATTTGAAATATATAAGTCTGTGTGTAATGAATGAATATAATATACAAGTTTCACTTTTTGAATGGAATTAGTGAAATAAATCAACTTTTTGATGATATTCTAATTATATGACCAGCACCTGTA

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU47230 True 204 lncRNA 0.30 1 3198562 3198765

Neighbor

gene id symbol gene type direction distance location
CI01000006_03164803_03183473 PCNX3 coding upstream 14843 3164189 ~ 3183719 (+)
CI01000006_03102358_03152576 NRXN2A coding upstream 45693 3102358 ~ 3152869 (+)
CI01000006_03016090_03016706 NA coding upstream 181248 3015137 ~ 3017314 (+)
CI01000006_02774064_02933983 NRXN2A coding upstream 264579 2774064 ~ 2933983 (+)
CI01000006_02665949_02677083 RASGRP2 coding upstream 521347 2665949 ~ 2677215 (+)
CI01000006_03232003_03242938 NA coding downstream 33238 3232003 ~ 3243362 (+)
CI01000006_03294091_03298089 SLC29A2 coding downstream 95223 3293988 ~ 3298671 (+)
CI01000006_03319103_03319306 NA coding downstream 120338 3319103 ~ 3319520 (+)
CI01000006_03327370_03334117 RIN1A coding downstream 128605 3327370 ~ 3334702 (+)
CI01000006_03350988_03356496 NA coding downstream 151999 3350764 ~ 3357157 (+)
G41605 NA non-coding upstream 276 3197836 ~ 3198286 (+)
G41547 NA non-coding upstream 144642 2976694 ~ 3053920 (+)
G41538 NA non-coding upstream 165852 3022098 ~ 3032710 (+)
G41554 NA non-coding upstream 192247 2995770 ~ 3006315 (+)
G41570 NA non-coding upstream 453765 2737136 ~ 2744797 (+)
G41614 NA non-coding downstream 50358 3249123 ~ 3250070 (+)
G41543 NA non-coding downstream 59284 3258049 ~ 3263442 (+)
G41555 NA non-coding downstream 69899 3268664 ~ 3336009 (+)
G41502 NA non-coding downstream 71199 3269964 ~ 3277004 (+)
G41513 NA non-coding downstream 84899 3283664 ~ 3288736 (+)
G41591 NA other upstream 359141 2836167 ~ 2839421 (+)
G41424 NA other upstream 537992 2645662 ~ 2660570 (+)
G41170 NA other upstream 1502741 1692065 ~ 1695821 (+)
G40768 NA other upstream 2705536 488407 ~ 493026 (+)
G40767 NA other upstream 2715227 360009 ~ 484185 (+)
CI01000006_03734862_03735227 BANF1, BANF1.S, BANF1.L other downstream 530465 3734554 ~ 3736035 (+)
G41996 NA other downstream 1918441 5117206 ~ 5124149 (+)
G43896 NA other downstream 2571324 5770089 ~ 5771775 (+)
CI01000006_06104927_06109730 NA other downstream 2909719 6104927 ~ 6109820 (+)
CI01000006_06122278_06122736 NA other downstream 2923270 6122035 ~ 6122751 (+)

Expression


Co-expression Network