G45055


Basic Information

Item Value
gene id G45055
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000006
NCBI id null
chromosome length 13024002
location 7325453 ~ 7325678 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU51210
GCGGTCTCAATGTTGCATTAGGGCCACTAGAGTATATTTGGTGCCAAGCACTCATGTCAATCTAGTTATTTGAGATCTGTAAAGCATCTACTCAATATTCAGTTGCAGCAGTAAAGAGGGATCCACTCAAGATAATGAGGTTTTCAATCTAAACAAGTATGTTATTTATAAGAGGTATGTTTGCTTGCTCTCGTCCGTGAAGTTCACGAGGCCACAGGGTGTCCCA

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU51210 True 226 lncRNA 0.42 1 7325453 7325678

Neighbor

gene id symbol gene type direction distance location
CI01000006_07231215_07235809 OXCT1.L, OXCT1B, OXCT1, OXCT1A coding downstream 89644 7231109 ~ 7235809 (-)
CI01000006_07223113_07228278 C7B, C7 coding downstream 97175 7223007 ~ 7228278 (-)
CI01000006_07200554_07201795 HTR1AB, HTR1A coding downstream 123555 7200311 ~ 7201898 (-)
CI01000006_07170860_07172808 NDR1 coding downstream 152561 7170624 ~ 7172892 (-)
CI01000006_07032358_07058942 RICTORB, RICTOR coding downstream 266511 7031186 ~ 7058942 (-)
CI01000006_07358910_07359982 NA coding upstream 32674 7358352 ~ 7360452 (-)
CI01000006_07444688_07448103 NA coding upstream 118911 7444589 ~ 7448103 (-)
CI01000006_07449425_07454936 NA coding upstream 123747 7449425 ~ 7455306 (-)
CI01000006_07456715_07457332 HSPB11 coding upstream 130785 7456463 ~ 7457379 (-)
CI01000006_07463938_07471236 PDE6B coding upstream 137512 7463190 ~ 7472462 (-)
G45054 NA non-coding downstream 238 7324841 ~ 7325215 (-)
G45053 NA non-coding downstream 2703 7322487 ~ 7322750 (-)
G45052 NA non-coding downstream 3350 7321600 ~ 7322103 (-)
G45002 NA non-coding downstream 127426 7197822 ~ 7198027 (-)
G45001 NA non-coding downstream 127824 7197412 ~ 7197629 (-)
CI01000006_07312005_07327873 EFNA5A non-coding upstream 549 7311793 ~ 7327901 (-)
G45077 NA non-coding upstream 79106 7404784 ~ 7405053 (-)
G45078 NA non-coding upstream 79471 7405149 ~ 7405447 (-)
G45811 NA non-coding upstream 146904 7472582 ~ 7472976 (-)
G45828 NA non-coding upstream 175907 7501585 ~ 7501933 (-)
CI01000006_06974359_06976736 NA other downstream 348581 6973224 ~ 6976872 (-)
CI01000006_04560607_04560993 NA other downstream 2763385 4559509 ~ 4562068 (-)
G43549 NA other downstream 2970025 4352510 ~ 4355428 (-)
G43102 NA other downstream 4391469 2908451 ~ 2933984 (-)
CI01000006_02624725_02626124 COX8A other downstream 4699267 2624436 ~ 2626776 (-)
CI01000006_07500281_07507754 NA other upstream 177467 7500246 ~ 7507976 (-)
CI01000006_10453630_10483241 NA other upstream 3157178 10453613 ~ 10484006 (-)
G47658 NA other upstream 3705233 11030911 ~ 11033127 (-)
CI01000006_11651067_11653761 SMD3, SNRPD3, SNRPD3L, MGC52856 other upstream 4324685 11650363 ~ 11654424 (-)
CI01000006_12348300_12348961 GLRX other upstream 5008731 12347180 ~ 12349383 (-)

Expression


Co-expression Network