G39457


Basic Information

Item Value
gene id G39457
gene name NA
gene type non-coding
species mexican tetra (Astyanax mexicanus)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_035901.1
NCBI id CM008304.1
chromosome length 40584741
location 547081 ~ 547352 (+)
genome version Astyanax_mexicanus-2.0_2017_mexican_tetra_Genome

Sequence

>TU53157
aattagaccgtttctgacgcaacaggccacccaactcctggtacaagcagtcgtcatctcacgcctcgactactgcaatgccctgctaactggcctcccggcctgcgtagtaaaaccactccaaatgatccagaatgcagcagcacgtctggtcttcaaccaaccaaaacgggcacatgtcaccccgctgctcattgagctccattggctaccagttgatgctcgcatcaaattcaaaactcttacaatcgcctacaaggtgatgacagaac

Function

GO:

id name namespace
GO:0010035 response to inorganic substance biological_process
GO:0010038 response to metal ion biological_process

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU53157 True 272 lncRNA 0.51 1 547081 547352

Neighbor

gene id symbol gene type direction distance location
cp cp,LOC100533122 coding upstream 13454 479272 ~ 533627 (+)
LOC103032607 LOC108439442 coding upstream 75877 461480 ~ 471204 (+)
LOC103032290 LOC108439433,LOC108271171 coding upstream 99766 417368 ~ 447315 (+)
wwtr1 wwtr1 coding upstream 166536 297267 ~ 380545 (+)
LOC103034506 kcnh1b,LOC108411957,LOC108270513,LOC107689936,LOC107753489,LOC106564801,LOC105026838 coding upstream 308085 159102 ~ 238996 (+)
LOC103036425 pax6,LOC103036425,LOC108444445 coding downstream 70805 618157 ~ 637895 (+)
immp1l immp1l,LOC107594745 coding downstream 124529 671881 ~ 681622 (+)
ankdd1a ankdd1a,LOC107685207 coding downstream 427585 974937 ~ 1000284 (+)
clpx clpx,clpxa,LOC107733949,LOC107737000,LOC107594724,LOC107600713 coding downstream 464287 1011639 ~ 1036934 (+)
ubap1l ubap1l,LOC107096871,LOC103363109,LOC105018181 coding downstream 500892 1048244 ~ 1071616 (+)
G39452 NA non-coding upstream 7253 539498 ~ 539828 (+)
G39372 NA non-coding upstream 8749 537105 ~ 538332 (+)
G39349 NA non-coding upstream 134893 411135 ~ 412188 (+)
G39352 NA non-coding upstream 177300 369143 ~ 369781 (+)
G39347 NA non-coding upstream 251512 295169 ~ 295569 (+)
G39459 NA non-coding downstream 257 547609 ~ 547813 (+)
LOC111192489 NA non-coding downstream 54504 601856 ~ 603927 (+)
G39504 NA non-coding downstream 165481 712833 ~ 715218 (+)
G39506 NA non-coding downstream 198216 745568 ~ 750620 (+)
G39511 snrpa1,LOC106587741 non-coding downstream 203470 750822 ~ 753837 (+)
commd2 commd2 other upstream 256059 281585 ~ 291022 (+)
plekho2 NA other downstream 375405 922757 ~ 963284 (+)
pdcd7 NA other downstream 491221 1038573 ~ 1045347 (+)
G39619 mrpl21 other downstream 659435 1206787 ~ 1209096 (+)
G39626 NA other downstream 672454 1219806 ~ 1220486 (+)
LOC111192492 NA other downstream 718505 1265857 ~ 1268385 (+)

Expression


Co-expression Network