G45986


Basic Information

Item Value
gene id G45986
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000006
NCBI id null
chromosome length 13024002
location 8080018 ~ 8080256 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU52296
GAACCCTAAAAAATATTTTGGATACTTAAGCAACAGTTAAATATATATACAGTAATGTTCAAAAGTTTGGGGTCGGTAAGATTTTTTGTTTTTAAAATAAGTCTGTTATGTTCAACAAGGCTGCATTTATTTAATCAAAATACTTCAAAGGGGACCTGTTATGCCTCTTTTCACAAGATGTAATATAAGTCTCTGGTTACCCCAGAATGTGTCTGTGAATTTTCAGTTCAAAATACCCC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU52296 True 239 lncRNA 0.32 1 8080018 8080256

Neighbor

gene id symbol gene type direction distance location
CI01000006_08020880_08024499 FAM175A coding downstream 55519 8020697 ~ 8024499 (-)
CI01000006_08009529_08018597 HELQ coding downstream 61421 8009529 ~ 8018597 (-)
CI01000006_08002867_08008150 HPSE coding downstream 71818 8002622 ~ 8008200 (-)
CI01000006_07997158_07999906 NA coding downstream 79905 7995424 ~ 8000113 (-)
CI01000006_07960990_07974726 AMACR coding downstream 104395 7960960 ~ 7975623 (-)
CI01000006_08080632_08085336 NA coding upstream 137 8080393 ~ 8085863 (-)
CI01000006_08149223_08150992 NKX6.1, NKX6-1 coding upstream 68237 8148493 ~ 8150992 (-)
CI01000006_08153453_08156753 RPL17P7, RPL17P6, RL17, RPL17.L, RPL17.S, RPL17, RPL17-C18ORF32, RPL17-PS9 coding upstream 73186 8153442 ~ 8157606 (-)
CI01000006_08194421_08196816 NA coding upstream 113875 8194131 ~ 8196885 (-)
CI01000006_08207762_08211601 CRKL coding upstream 126415 8206671 ~ 8212202 (-)
G45985 NA non-coding downstream 322 8079468 ~ 8079696 (-)
G45970 NA non-coding downstream 40069 8039680 ~ 8039949 (-)
G45960 NA non-coding downstream 149324 7930402 ~ 7930694 (-)
G45928 NA non-coding downstream 247422 7831145 ~ 7832596 (-)
G45903 NA non-coding downstream 277269 7802534 ~ 7802749 (-)
G46018 NA non-coding upstream 117976 8198232 ~ 8276329 (-)
G46106 NA non-coding upstream 328706 8408962 ~ 8835381 (-)
G46089 NA non-coding upstream 400993 8481249 ~ 8498802 (-)
G46199 NA non-coding upstream 896415 8976671 ~ 8976871 (-)
G46102 NA non-coding upstream 918837 8999093 ~ 9008209 (-)
CI01000006_07500281_07507754 NA other downstream 569062 7500246 ~ 7507976 (-)
CI01000006_06974359_06976736 NA other downstream 1103146 6973224 ~ 6976872 (-)
CI01000006_04560607_04560993 NA other downstream 3517950 4559509 ~ 4562068 (-)
G43549 NA other downstream 3724590 4352510 ~ 4355428 (-)
G43102 NA other downstream 5146034 2908451 ~ 2933984 (-)
CI01000006_10453630_10483241 NA other upstream 2402600 10453613 ~ 10484006 (-)
G47658 NA other upstream 2950655 11030911 ~ 11033127 (-)
CI01000006_11651067_11653761 SMD3, SNRPD3, SNRPD3L, MGC52856 other upstream 3570107 11650363 ~ 11654424 (-)
CI01000006_12348300_12348961 GLRX other upstream 4254153 12347180 ~ 12349383 (-)
CI01000006_12569291_12581457 CELL, CEL.2, CEL.1 other upstream 4270503 12569205 ~ 12582487 (-)

Expression


Co-expression Network