G42469



Basic Information


Item Value
gene id G42469
gene name NA
gene type non-coding
species mexican tetra (Astyanax mexicanus)
category of species ornamental fish

Chromosome Information


Item Value
chromosome id NC_035901.1
NCBI id CM008304.1
chromosome length 40584741
location 14160405 ~ 14160711 (+)
genome version Astyanax_mexicanus-2.0_2017_mexican_tetra_Genome

Sequence


>TU57189
TTAAGGATGGAAGGCTACTCAATGCGAGATATTGCCAAGAAACTGAAAATATTCACTATTACCATGCTGTTACTACTACTCCCTTCGAAATGTGACACAGACTGGCTCTAACAAGGACAGAGAAAGGAGTGGGAGGCCCCGATGCACAACTGTGCAAGAAGATAAATATCTTAGAGCGTGCAGTTTGAGAGAAAGATGCCTCACAGGCTGTCCACTGATAGCTGCACTAAATGGAGCCCGTCAAACACCGGTGTCAGCATCAACGGTCCAGAGGCGACTTTAAGATTCTGGACTTCATGGCAGAATT

Function


NR:

description
PREDICTED: cyclin-dependent kinase 15

GO:

id name namespace
GO:0038032 termination of G protein-coupled receptor signaling pathway biological_process
GO:0045744 negative regulation of G protein-coupled receptor signaling pathway biological_process
GO:0023021 termination of signal transduction biological_process
GO:0008277 regulation of G protein-coupled receptor signaling pathway biological_process

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU57189 True 307 lncRNA 0.46 1 14160405 14160711

Neighbor


gene id symbol gene type direction distance location
zbtb37 zbtb37,LOC107592717,LOC107669813,LOC107715094,LOC107588062,LOC107757485 coding upstream 161980 13989840 ~ 13998425 (+)
s1pr1 s1pr1,LOC107715096,LOC107592715,LOC107669844 coding upstream 175924 13981191 ~ 13984481 (+)
slc30a7 slc30a7,LOC107588064 coding upstream 269273 13861717 ~ 13891132 (+)
gpr88 gpr88 coding upstream 355299 13801468 ~ 13805106 (+)
cdc14a cdc14a coding upstream 366686 13710046 ~ 13793719 (+)
mrpl54 mrpl54,LOC102788358 coding downstream 146012 14306723 ~ 14309631 (+)
LOC103040508 LOC108414270 coding downstream 151787 14312498 ~ 14333039 (+)
LOC103042131 LOC108424984 coding downstream 173384 14334095 ~ 14345180 (+)
LOC103041829 NA coding downstream 198498 14359209 ~ 14412035 (+)
bsg NA coding downstream 301939 14462650 ~ 14480454 (+)
G42446 NA non-coding upstream 14048 14086909 ~ 14146357 (+)
G42442 NA non-coding upstream 87069 14056598 ~ 14073336 (+)
G42386 NA non-coding upstream 135009 14021643 ~ 14025396 (+)
G42389 NA non-coding upstream 157708 13998920 ~ 14002697 (+)
G42220 LOC108429511,LOC100711005,LOC101481666,LOC102215641,LOC107731533,LOC103137085,LOC107715111 non-coding upstream 624379 13530352 ~ 13536026 (+)
G42496 fam32a,LOC107757479 non-coding downstream 142707 14303418 ~ 14306941 (+)
G42527 NA non-coding downstream 216767 14377478 ~ 14378030 (+)
G42521 NA non-coding downstream 251578 14412289 ~ 14413746 (+)
LOC111192557 NA non-coding downstream 377610 14538321 ~ 14560369 (+)
G42564 NA non-coding downstream 467146 14627857 ~ 14669283 (+)
eps15l1 eps15l1 other upstream 25859 14070423 ~ 14134546 (+)
LOC103037142 LOC108429501 other upstream 303044 13810833 ~ 13857361 (+)
LOC103034435 NA other upstream 538363 13617083 ~ 13622042 (+)
LOC103032215 NA other upstream 638148 13509020 ~ 13522257 (+)
G42208 ier5 other upstream 709928 13448592 ~ 13450477 (+)
G42605 NA other downstream 734351 14895062 ~ 14899248 (+)
LOC103036127 cunh19orf24 other downstream 1817775 15978486 ~ 15984632 (+)
LOC103040819 reep6,LOC107698004,LOC107745351,LOC107658751 other downstream 2280220 16440931 ~ 16446287 (+)
LOC103044285 NA other downstream 2655890 16816601 ~ 16819251 (+)
LOC111192574 NA other downstream 2787669 16948380 ~ 16950360 (+)

Expression



Co-expression Network