G42647 (txlng,LOC107665847)


Basic Information

Item Value
gene id G42647
gene name txlng,LOC107665847
gene type non-coding
species mexican tetra (Astyanax mexicanus)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_035901.1
NCBI id CM008304.1
chromosome length 40584741
location 15057215 ~ 15057675 (+)
genome version Astyanax_mexicanus-2.0_2017_mexican_tetra_Genome

Sequence

>TU57464
CTCCTCTCTCAGTTCATACTGCTCAATAAGTTTCTTGAGTTTTTCAGCCAGCTCCATATTCTCCTGCCTCAGCTTGGTGTTATGGGAGTTATGCTGCTCCATCTGCTCTTCAATCTCATTAAGTGTCATCTGAAAGTGCAGCGTGGCCTCCTTACGCCTCTCTTCGTATTCTCTGAACCTCTGGGCATTCTCCTCCTTCAGGGTCTTGTTGTGCCGTTGTAGCTCTCTGCAAAGGCTTTCCAGCTTGCTCCGAGCTAGAATGGCTTTGCTGTGTTCACTCTGCAAATGAATCTTCTCTTTGAGGACCTGGG

Function

symbol description
txlng Predicted to enable syntaxin binding activity. Predicted to be involved in regulation of cell cycle. Orthologous to human TXLNG (taxilin gamma).

NR:

description
Zgc:136409

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU57464 True 311 lncRNA 0.48 2 15057215 15057675

Neighbor

gene id symbol gene type direction distance location
LOC103023991 rbbp7,rbb4l,LOC103023991,LOC108438657,LOC105893332 coding upstream 5440 15045274 ~ 15051775 (+)
LOC103022023 NA coding upstream 62599 14972261 ~ 14994616 (+)
LOC103045821 plak,LOC108438667,LOC108270763,LOC107562072,LOC107680531,LOC107753847 coding upstream 188476 14834224 ~ 14868739 (+)
LOC103026778 NA coding upstream 331258 14711374 ~ 14725957 (+)
LOC103026177 fgf22,LOC106613753,LOC106584266 coding upstream 397190 14622178 ~ 14660025 (+)
rtel1 rtel1,LOC107579445 coding downstream 4952 15062627 ~ 15089931 (+)
zgpat zgpat coding downstream 33696 15091371 ~ 15097213 (+)
ptgfr ptgfr coding downstream 73302 15130977 ~ 15136409 (+)
LOC103026176 bt3l4,btf3l4,LOC103026176,LOC105028135,LOC107562065 coding downstream 80589 15138264 ~ 15141396 (+)
LOC103027567 LOC108438649,LOC108270756 coding downstream 85794 15143469 ~ 15170638 (+)
G42637 txlng non-coding upstream 2335 15017800 ~ 15054880 (+)
G42636 npepps,LOC107098842,LOC102793525 non-coding upstream 37680 15014943 ~ 15019535 (+)
G42633 NA non-coding upstream 46241 15010480 ~ 15010974 (+)
G42632 NA non-coding upstream 55119 15000435 ~ 15002096 (+)
G42626 NA non-coding upstream 90345 14966150 ~ 14966870 (+)
G42648 txlng non-coding downstream 943 15058618 ~ 15061447 (+)
G42756 LOC108438650,LOC108270818,LOC107656106,LOC107753833,LOC107562086,LOC107602768,LOC107723066 non-coding downstream 44801 15102476 ~ 15191970 (+)
G42763 NA non-coding downstream 107040 15164715 ~ 15165694 (+)
G42807 NA non-coding downstream 320326 15378001 ~ 15378608 (+)
G42810 NA non-coding downstream 357002 15414677 ~ 15415189 (+)
G42605 NA other upstream 157967 14895062 ~ 14899248 (+)
eps15l1 eps15l1 other upstream 922669 14070423 ~ 14134546 (+)
LOC103037142 LOC108429501 other upstream 1199854 13810833 ~ 13857361 (+)
LOC103034435 NA other upstream 1435173 13617083 ~ 13622042 (+)
LOC103032215 NA other upstream 1534958 13509020 ~ 13522257 (+)
LOC103036127 cunh19orf24 other downstream 920811 15978486 ~ 15984632 (+)
LOC103040819 reep6,LOC107698004,LOC107745351,LOC107658751 other downstream 1383256 16440931 ~ 16446287 (+)
LOC103044285 NA other downstream 1758926 16816601 ~ 16819251 (+)
LOC111192574 NA other downstream 1890705 16948380 ~ 16950360 (+)
dda1 dda1,LOC105913185,LOC107685208,LOC105012003 other downstream 1954792 17012467 ~ 17017856 (+)

Expression


Co-expression Network