G45765


Basic Information

Item Value
gene id G45765
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000006
NCBI id null
chromosome length 13024002
location 8997082 ~ 8997321 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU52027
CTCATGTGATTCATTATGGCTTGTAGCCTATTATTTCATAGTCAATTCTAACAATCAACTTCTCCTGAGTAATATAGACTAAAAGCGACTAAAAGAGACTGTTGTTGACAAACCTGGCTTATTTCGATGTAGTTTTGATGCCACATTCATCCTCAAACAGAAACTAAAGAGAGGCATTCATGCTAGTCGAGGTCATCGTCGAGTCGGGGATCAAAAGTTCAGACAAATTCAGCTTTCACG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU52027 True 240 lncRNA 0.39 1 8997082 8997321

Neighbor

gene id symbol gene type direction distance location
CI01000006_08847431_08853895 NA coding upstream 143161 8846260 ~ 8853921 (+)
CI01000006_08757702_08765273 WDR5, WDR5B, WDR5.L, BRAFLDRAFT_281422 coding upstream 231020 8757419 ~ 8766062 (+)
CI01000006_08673737_08674685 NA coding upstream 321968 8673580 ~ 8675114 (+)
CI01000006_08528828_08531392 NA coding upstream 465625 8528828 ~ 8531457 (+)
CI01000006_08366730_08400944 NA coding upstream 594757 8366090 ~ 8402325 (+)
CI01000006_09004949_09014310 GSNA, GSN coding downstream 7353 9004674 ~ 9014589 (+)
CI01000006_09066050_09070383 BARH1, BARHL1B, BARHL1 coding downstream 68641 9065962 ~ 9070581 (+)
CI01000006_09098943_09103197 NA coding downstream 101361 9098682 ~ 9104172 (+)
CI01000006_09105004_09106470 NA coding downstream 106894 9104215 ~ 9106963 (+)
CI01000006_09107491_09114820 GTF3C4 coding downstream 109505 9106826 ~ 9115071 (+)
G45748 NA non-coding upstream 41577 8955299 ~ 8955505 (+)
G45734 NA non-coding upstream 73036 8923830 ~ 8924046 (+)
G45413 NA non-coding upstream 246586 8749911 ~ 8750496 (+)
G45543 NA non-coding upstream 257484 8682981 ~ 8739598 (+)
G45630 NA non-coding upstream 291415 8705333 ~ 8705667 (+)
G45769 NA non-coding downstream 33039 9030360 ~ 9037570 (+)
G45778 NA non-coding downstream 43646 9040967 ~ 9041168 (+)
G45787 NA non-coding downstream 56663 9053984 ~ 9054296 (+)
G45796 NA non-coding downstream 81120 9078441 ~ 9078662 (+)
G46246 NA non-coding downstream 92705 9090026 ~ 9090232 (+)
G45416 NA other upstream 162385 8818814 ~ 8834697 (+)
G45355 NA other upstream 784694 8209555 ~ 8212388 (+)
CI01000006_08198328_08199463 NA other upstream 796937 8197881 ~ 8200145 (+)
G45336 NA other upstream 975131 8019342 ~ 8021951 (+)
G45265 NA other upstream 1076727 7883867 ~ 7920355 (+)
G46652 NA other downstream 1159258 10156579 ~ 10159251 (+)
G47145 NA other downstream 1488037 10485358 ~ 10511806 (+)
G47159 NA other downstream 2418908 11416229 ~ 11521703 (+)
G47318 NA other downstream 2626946 11624267 ~ 11638252 (+)
G48094 NA other downstream 3280299 12277620 ~ 12279541 (+)

Expression


Co-expression Network