G46986


Basic Information

Item Value
gene id G46986
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000006
NCBI id null
chromosome length 13024002
location 10017583 ~ 10017849 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU53426
TTTCAAAACACTGCTTCATGAAGCTTTACGAATCTTTTGTCTCGAATCAGTGGTATGGAGCGTGTATCAAACTGCCAAAGTCATGTACTATTGAAAATCCGAAACACTTATGACGTAACGAAGCCTCGTTTACTGAAATCACGCGATTTTGGCGTTCTGAACCACTGATTCGAAACAAAAGATCCGTAAAGCTCCGAAGCTTCATGAAGCAGTGTTTTGAAATCGCCCATCACTACATATTGTTGAATAAAGTCGTTATTTTTTTTT

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU53426 True 267 lncRNA 0.38 1 10017583 10017849

Neighbor

gene id symbol gene type direction distance location
CI01000006_09870216_09870854 NA coding downstream 146729 9869797 ~ 9870854 (-)
CI01000006_09857830_09868080 NA coding downstream 149346 9857816 ~ 9868237 (-)
CI01000006_09383325_09387907 AQP3B, AQP3 coding downstream 629676 9383270 ~ 9387907 (-)
CI01000006_09338560_09342684 VPS29 coding downstream 673800 9338265 ~ 9343783 (-)
CI01000006_09330816_09334587 ATPBB, GPN3 coding downstream 682818 9330616 ~ 9334765 (-)
CI01000006_10044550_10045827 NA coding upstream 26201 10044050 ~ 10047230 (-)
CI01000006_10053771_10055045 NA coding upstream 35674 10053523 ~ 10055823 (-)
CI01000006_10078319_10079570 NA coding upstream 59914 10077763 ~ 10079570 (-)
CI01000006_10086956_10090090 NA coding upstream 68706 10086555 ~ 10090090 (-)
CI01000006_10096004_10116009 PTPRA coding upstream 78035 10095884 ~ 10116009 (-)
CI01000006_10016544_10031947 FAM169AB non-coding downstream 207 10016375 ~ 10031947 (-)
G46979 NA non-coding downstream 21841 9995539 ~ 9995742 (-)
G46973 NA non-coding downstream 28147 9989204 ~ 9989436 (-)
G46972 NA non-coding downstream 28972 9988401 ~ 9988611 (-)
G46902 NA non-coding downstream 96410 9918579 ~ 9921173 (-)
G47024 NA non-coding upstream 176583 10194432 ~ 10194641 (-)
G47035 NA non-coding upstream 214330 10232179 ~ 10232399 (-)
G47053 NA non-coding upstream 246232 10264081 ~ 10264320 (-)
G47410 NA non-coding upstream 291031 10308880 ~ 10309101 (-)
CI01000006_10349084_10362629 NA non-coding upstream 341451 10348973 ~ 10363587 (-)
CI01000006_07500281_07507754 NA other downstream 2506627 7500246 ~ 7507976 (-)
CI01000006_06974359_06976736 NA other downstream 3040711 6973224 ~ 6976872 (-)
CI01000006_04560607_04560993 NA other downstream 5455515 4559509 ~ 4562068 (-)
G43549 NA other downstream 5662155 4352510 ~ 4355428 (-)
G43102 NA other downstream 7083599 2908451 ~ 2933984 (-)
CI01000006_10453630_10483241 NA other upstream 465007 10453613 ~ 10484006 (-)
G47658 NA other upstream 1013062 11030911 ~ 11033127 (-)
CI01000006_11651067_11653761 SMD3, SNRPD3, SNRPD3L, MGC52856 other upstream 1632514 11650363 ~ 11654424 (-)
CI01000006_12348300_12348961 GLRX other upstream 2316560 12347180 ~ 12349383 (-)
CI01000006_12569291_12581457 CELL, CEL.2, CEL.1 other upstream 2332910 12569205 ~ 12582487 (-)

Expression


Co-expression Network