G47868



Basic Information


Item Value
gene id G47868
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000006
NCBI id null
chromosome length 13024002
location 11777411 ~ 11777636 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU54472
GGCGGCACATGCTAGTCGATGAGTTGAATCAACTCCACAGCAACTACATAAATTTATCCACTAACTGTTCAGAAACATCCAGATGCATTCTAAAAGTTGTAACTTCTTCCTGAGTCTCTCCATCAGTGTCCGACTCTGGTTTGAACAATGTAAATTTGAACACCGTAACTGACAATTGTCAATTTGCTGCGTGAGATTCTCCAGCTTTGTTTTTGTTGAGCAACCG

Function


GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA


RNA id representative length rna type GC content exon number start site end site
TU54472 True 226 lncRNA 0.32 1 11777411 11777636

Neighbor


gene id symbol gene type direction distance location
CI01000006_11753992_11763149 ODF2, ODF2A coding downstream 14262 11753728 ~ 11763149 (-)
CI01000006_11715016_11740679 SPTAN1, SPNA2 coding downstream 36648 11714705 ~ 11740763 (-)
CI01000006_11672314_11695885 SPECC1L, SPECC1LB coding downstream 81491 11671854 ~ 11695920 (-)
CI01000006_11659293_11664444 ADORA2AB coding downstream 111161 11658933 ~ 11666250 (-)
CI01000006_11651067_11653761 SMD3, SNRPD3, SNRPD3L, MGC52856 coding downstream 122987 11650363 ~ 11654424 (-)
CI01000006_11779363_11781944 NA coding upstream 1689 11779325 ~ 11781988 (-)
CI01000006_12195900_12218340 KIAA1328 coding upstream 418264 12195900 ~ 12218340 (-)
CI01000006_12223358_12227336 NA coding upstream 445676 12223312 ~ 12227427 (-)
CI01000006_12238313_12238815 NA coding upstream 460677 12238313 ~ 12239051 (-)
CI01000006_12252567_12267751 UBAP2, UBAP2A coding upstream 474295 12251931 ~ 12267751 (-)
G47864 NA non-coding downstream 4985 11772143 ~ 11772426 (-)
G47863 NA non-coding downstream 7169 11769938 ~ 11770242 (-)
G47861 NA non-coding downstream 11824 11765234 ~ 11765587 (-)
G47705 NA non-coding downstream 69154 11704927 ~ 11708257 (-)
G47854 NA non-coding downstream 129246 11645527 ~ 11648165 (-)
G47869 NA non-coding upstream 529 11778165 ~ 11778517 (-)
G47871 NA non-coding upstream 2374 11780010 ~ 11780381 (-)
G47873 NA non-coding upstream 5969 11783605 ~ 11783964 (-)
G47877 NA non-coding upstream 11988 11789624 ~ 11789823 (-)
G47879 NA non-coding upstream 16314 11793950 ~ 11794211 (-)
G47658 NA other downstream 744284 11030911 ~ 11033127 (-)
CI01000006_10453630_10483241 NA other downstream 1288976 10453613 ~ 10484006 (-)
CI01000006_07500281_07507754 NA other downstream 4266455 7500246 ~ 7507976 (-)
CI01000006_06974359_06976736 NA other downstream 4800539 6973224 ~ 6976872 (-)
CI01000006_12348300_12348961 GLRX other upstream 556773 12347180 ~ 12349383 (-)
CI01000006_12569291_12581457 CELL, CEL.2, CEL.1 other upstream 573123 12569205 ~ 12582487 (-)

Expression



Co-expression Network