G47879


Basic Information

Item Value
gene id G47879
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000006
NCBI id null
chromosome length 13024002
location 11793950 ~ 11794211 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU54483
TGCAGCACTAGTGTATGTACCAAGAGGGGCCTGACGTTGATGGAGAGGGTGATTTCAGGCCTTGCCGTTAGCAGGAGGAGATAGAATATCTTCTTAAGGCCCAAGGATAGCACTTTTTATGAGATGTTCATTGCAGAAGCTACATCAACCTGTCTAGAGCTACTGCAAGCCCATCGCCTCCTTCTCTCCCTCTCTTTCATCACTCCCATTCTCTTGCCCATATCCACTACCTCTTTCCTCTGCCTCTTTCATTGAACTTTTC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU54483 True 262 lncRNA 0.52 1 11793950 11794211

Neighbor

gene id symbol gene type direction distance location
CI01000006_11779363_11781944 NA coding downstream 11962 11779325 ~ 11781988 (-)
CI01000006_11753992_11763149 ODF2, ODF2A coding downstream 30801 11753728 ~ 11763149 (-)
CI01000006_11715016_11740679 SPTAN1, SPNA2 coding downstream 53187 11714705 ~ 11740763 (-)
CI01000006_11672314_11695885 SPECC1L, SPECC1LB coding downstream 98030 11671854 ~ 11695920 (-)
CI01000006_11659293_11664444 ADORA2AB coding downstream 127700 11658933 ~ 11666250 (-)
CI01000006_12195900_12218340 KIAA1328 coding upstream 401689 12195900 ~ 12218340 (-)
CI01000006_12223358_12227336 NA coding upstream 429101 12223312 ~ 12227427 (-)
CI01000006_12238313_12238815 NA coding upstream 444102 12238313 ~ 12239051 (-)
CI01000006_12252567_12267751 UBAP2, UBAP2A coding upstream 457720 12251931 ~ 12267751 (-)
CI01000006_12274550_12280868 DCAF12 coding upstream 478870 12273081 ~ 12280868 (-)
G47877 NA non-coding downstream 4127 11789624 ~ 11789823 (-)
G47873 NA non-coding downstream 9986 11783605 ~ 11783964 (-)
G47871 NA non-coding downstream 13569 11780010 ~ 11780381 (-)
G47869 NA non-coding downstream 15433 11778165 ~ 11778517 (-)
G47868 NA non-coding downstream 16314 11777411 ~ 11777636 (-)
G47883 NA non-coding upstream 4431 11798642 ~ 11798905 (-)
G47885 NA non-coding upstream 5529 11799740 ~ 11800111 (-)
G47887 NA non-coding upstream 7383 11801594 ~ 11801814 (-)
G47888 NA non-coding upstream 8027 11802238 ~ 11802458 (-)
G47934 NA non-coding upstream 58948 11853159 ~ 11853365 (-)
CI01000006_11651067_11653761 SMD3, SNRPD3, SNRPD3L, MGC52856 other downstream 139543 11650363 ~ 11654424 (-)
G47658 NA other downstream 760823 11030911 ~ 11033127 (-)
CI01000006_10453630_10483241 NA other downstream 1305515 10453613 ~ 10484006 (-)
CI01000006_07500281_07507754 NA other downstream 4282994 7500246 ~ 7507976 (-)
CI01000006_06974359_06976736 NA other downstream 4817078 6973224 ~ 6976872 (-)
CI01000006_12348300_12348961 GLRX other upstream 540198 12347180 ~ 12349383 (-)
CI01000006_12569291_12581457 CELL, CEL.2, CEL.1 other upstream 556548 12569205 ~ 12582487 (-)

Expression


Co-expression Network