G77214


Basic Information

Item Value
gene id G77214
gene name NA
gene type non-coding
species mexican tetra (Astyanax mexicanus)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_035905.1
NCBI id CM008308.1
chromosome length 42966623
location 965814 ~ 1050942 (+)
genome version Astyanax_mexicanus-2.0_2017_mexican_tetra_Genome

Sequence

>TU104126
tcccacactgtgtctcttggtgcagctgtgcagctatagctgcaaaaaaacagcaaaagcaaaccacctggcctttttcacctcctggacctgagcatgaacttcagagcagctgtttactctccactccagcaaaagatgctccacatatgagctgctaactcatccatttccctttataaagctacgagtctctcctctctctaatatgagggttttgttgttggtgaagaaggaggtgtttatacaggtatcaatgtgcagcatgtgagacgcttcaggaacagattctgtgttc

Function

GO:

id name namespace
GO:0009250 glucan biosynthetic process biological_process
GO:0006073 cellular glucan metabolic process biological_process
GO:0033692 cellular polysaccharide biosynthetic process biological_process
GO:0006091 generation of precursor metabolites and energy biological_process
GO:0006112 energy reserve metabolic process biological_process
GO:0044262 cellular carbohydrate metabolic process biological_process
GO:0044264 cellular polysaccharide metabolic process biological_process
GO:0015980 energy derivation by oxidation of organic compounds biological_process
GO:0005975 carbohydrate metabolic process biological_process
GO:0005976 polysaccharide metabolic process biological_process
GO:0005977 glycogen metabolic process biological_process
GO:0005978 glycogen biosynthetic process biological_process
GO:0034637 cellular carbohydrate biosynthetic process biological_process
GO:0044042 glucan metabolic process biological_process
GO:0000271 polysaccharide biosynthetic process biological_process
GO:0016051 carbohydrate biosynthetic process biological_process

KEGG:

id description
ko00010 Glycolysis / Gluconeogenesis

RNA

RNA id representative length rna type GC content exon number start site end site
TU104126 True 298 lncRNA 0.46 2 965814 1050942

Neighbor

gene id symbol gene type direction distance location
eef1akmt2 mettl10 coding upstream 127661 834977 ~ 838153 (+)
arhgap5 arhgap5,LOC107594795,LOC107733129,LOC107719447,LOC107561551 coding upstream 151124 776124 ~ 814690 (+)
nubpl nubpl,LOC107719449,LOC107697759,LOC107561549,LOC107733195,LOC107674123 coding upstream 204091 754239 ~ 761723 (+)
cinp NA coding upstream 294239 667205 ~ 671575 (+)
adprhl2 adprhl2,LOC107697751,LOC107674064,LOC107594801,LOC107719508 coding upstream 299510 661539 ~ 666304 (+)
LOC103043042 LOC108436743,LOC108269478,LOC107752797,LOC107733148,LOC107697766 coding downstream 136178 1187120 ~ 1203142 (+)
LOC107197738 ywhaqb,LOC108436740,LOC107733143,LOC107752793,LOC107592764,LOC107697768,LOC105896734 coding downstream 253125 1304067 ~ 1318118 (+)
gcfc2 gcfc2 coding downstream 268477 1319419 ~ 1329088 (+)
LOC103037734 LOC105015678,LOC106588052 coding downstream 419073 1470015 ~ 1479658 (+)
mthfd1 mthfd1,LOC108269612 coding downstream 447180 1498122 ~ 1514730 (+)
G77198 NA non-coding upstream 28581 936248 ~ 937233 (+)
G77207 NA non-coding upstream 52154 913108 ~ 913660 (+)
G77203 NA non-coding upstream 57534 907806 ~ 908280 (+)
G77201 NA non-coding upstream 61828 903418 ~ 903986 (+)
G77200 NA non-coding upstream 62575 903038 ~ 903239 (+)
G77245 NA non-coding downstream 187402 1238344 ~ 1238806 (+)
G77259 NA non-coding downstream 214895 1265837 ~ 1266074 (+)
G77375 NA non-coding downstream 293154 1344096 ~ 1345264 (+)
G77376 NA non-coding downstream 294401 1345343 ~ 1349654 (+)
G77373 NA non-coding downstream 317160 1368102 ~ 1368585 (+)
LOC103037215 fam196ab,LOC108436749,LOC108269663,LOC107561539,LOC107733200,LOC107674119 other upstream 30136 883297 ~ 935678 (+)
G77154 NA other upstream 333442 631714 ~ 632372 (+)
G77059 NA other upstream 445224 519633 ~ 520590 (+)
ldah ldah other upstream 832511 84719 ~ 133303 (+)
G77410 NA other downstream 433728 1484670 ~ 1485050 (+)
c9h15orf52 NA other downstream 478028 1528970 ~ 1563180 (+)
G77471 bub1b other downstream 642414 1693356 ~ 1696981 (+)
zfyve19 zfyve19 other downstream 647023 1697965 ~ 1708297 (+)
LOC103033080 akt1,zbtb42,LOC107716055,LOC106610857,LOC106582697 other downstream 861590 1912532 ~ 2009418 (+)

Expression


Co-expression Network