G48101


Basic Information

Item Value
gene id G48101
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000006
NCBI id null
chromosome length 13024002
location 12308142 ~ 12349571 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU54715
TCATGAGCAGTGGTTTTCATTTACTGGTTTCATTTTAGTTCATTTAGGACAATCTGTATGATGCAAGAGTTAGCAAAATAACTTGCATACAATTCATACATTTCTGATTCATTACAAGTCACTTAAACTGCAACTTCGAAAAAATGTACAGTATGTGGAGAAGCTTTTGTGGAAACAAAAGTGACAATTAGATTGTATAATTAGGTGTATAAAAAGTGTCTAAGGACCACAGTGTCTTCCCAAGACTTGCCTTAAAGGGATAGTTCACCCAAAAATGAAAAATATCCCATGA

Function

NR:

description
PREDICTED: chromodomain-helicase-DNA-binding protein 6-like isoform X1

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU54715 True 292 lncRNA 0.34 2 12308142 12349571

Neighbor

gene id symbol gene type direction distance location
CI01000006_12307031_12307314 NA coding upstream 823 12307031 ~ 12307319 (+)
CI01000006_12298229_12304430 UB2R2, CDC34, UBE2R2, UBE2R2.S, CDC34A, CDC34B coding upstream 3539 12297797 ~ 12304603 (+)
CI01000006_12242654_12249350 NOP56, NOP56.L coding upstream 58587 12242654 ~ 12249555 (+)
CI01000006_12230746_12235389 NA coding upstream 72617 12229547 ~ 12235525 (+)
CI01000006_12219317_12222975 TPGS2 coding upstream 85025 12219317 ~ 12223117 (+)
CI01000006_12447621_12461167 NA coding downstream 98050 12447621 ~ 12461191 (+)
CI01000006_12592270_12606447 NA coding downstream 242267 12591838 ~ 12607314 (+)
CI01000006_12608120_12620040 NA coding downstream 258549 12608120 ~ 12620111 (+)
CI01000006_12684154_12695960 DNAJC21 coding downstream 333990 12683561 ~ 12696396 (+)
CI01000006_12764729_12782405 NA coding downstream 414345 12763916 ~ 12783368 (+)
G48086 NA non-coding upstream 46798 12259495 ~ 12261344 (+)
G48214 NA non-coding upstream 79888 12228047 ~ 12228254 (+)
G48119 NA non-coding upstream 150436 12143871 ~ 12157706 (+)
G48113 NA non-coding upstream 190122 12103183 ~ 12118020 (+)
G48146 NA non-coding upstream 302639 12005256 ~ 12005503 (+)
G48075 NA non-coding downstream 1191 12350762 ~ 12571161 (+)
G48251 NA non-coding downstream 147783 12497354 ~ 12500200 (+)
G48122 NA non-coding downstream 169775 12519346 ~ 12532674 (+)
G48270 NA non-coding downstream 227924 12577495 ~ 12577940 (+)
G48079 NA non-coding downstream 230754 12580325 ~ 12582476 (+)
G48094 NA other upstream 28601 12277620 ~ 12279541 (+)
G47318 NA other upstream 669890 11624267 ~ 11638252 (+)
G47159 NA other upstream 786439 11416229 ~ 11521703 (+)
G47145 NA other upstream 1796336 10485358 ~ 10511806 (+)
G46652 NA other upstream 2148891 10156579 ~ 10159251 (+)
G48081 NA other downstream 27435 12377006 ~ 12384827 (+)

Expression


Co-expression Network