G83795 (aqr)


Basic Information

Item Value
gene id G83795
gene name aqr
gene type non-coding
species mexican tetra (Astyanax mexicanus)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_035905.1
NCBI id CM008308.1
chromosome length 42966623
location 27087200 ~ 27100573 (+)
genome version Astyanax_mexicanus-2.0_2017_mexican_tetra_Genome

Sequence

>TU112907
GATGTAGTCATTCTGCTGACCCTGGAACCTGTCCACTGTTGTCACTTTGCTGGGCTGGCCGAAGAATGGGTTGTTGGCACAGCGCTGGTTGATGACATCTCGGATTAAGTGCTTCTGGCCGTTGTAGGTGGTGAGGATACTGATACGCTCGGCTGGATAACCCAACAGCCTCATGTACATGAACAGAGCCACAGAGTACTCTGCCTCAGCCAGGTTCTGGTAGAAGTAGGGGTTAGGTTCAGACTCCCCAACACCATTGAAGTCCTCCACATTGATGAGCTGGAAGTCATAGGCCAGGCCTGGGTTGGGAGCCTGGAACTCTGTTTGACGTTGAACGTGAGGGAGATTTCCCAGCTGCTTGTAGCGCCAGTTATACAGATTACACAGGCTG

Function

symbol description
aqr Predicted to enable mRNA binding activity. Predicted to act upstream of or within mRNA splicing, via spliceosome. Predicted to be located in nucleus. Predicted to be part of catalytic step 2 spliceosome. Orthologous to human AQR (aquarius intron-binding spliceosomal factor).

NR:

description
PREDICTED: intron-binding protein aquarius isoform X1

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU112907 True 391 lncRNA 0.52 3 27087200 27100573

Neighbor

gene id symbol gene type direction distance location
stxbp6 stxbp6 coding upstream 190132 26795808 ~ 26897068 (+)
LOC103023862 ddhd1 coding upstream 371185 26693418 ~ 26716015 (+)
bmp4 bmp4 coding upstream 473436 26604718 ~ 26613764 (+)
snx14 snx14 coding upstream 580688 26488033 ~ 26506512 (+)
LOC103026145 LOC108270054,LOC108423543 coding upstream 602578 26474775 ~ 26484622 (+)
c9h15orf41 cunh15orf41,c9h15orf41,cssa01h15orf41,clg19h15orf41,LOC105897278 coding downstream 328179 27428752 ~ 27506291 (+)
spred1 spred1 coding downstream 670220 27770793 ~ 27813908 (+)
LOC103043868 atxn3,LOC108423524,LOC106596382,LOC107575702,LOC107683100 coding downstream 748104 27848677 ~ 27855382 (+)
LOC103042318 LOC103042318,LOC108423523 coding downstream 755168 27855741 ~ 27858741 (+)
ddx24 ddx24 coding downstream 759621 27860194 ~ 27869973 (+)
LOC111193233 NA non-coding upstream 5013 27070705 ~ 27082187 (+)
G83785 NA non-coding upstream 32932 27047546 ~ 27054268 (+)
LOC111193232 NA non-coding upstream 162982 26904881 ~ 26924218 (+)
G83761 NA non-coding upstream 362587 26724339 ~ 26724613 (+)
G83759 NA non-coding upstream 364195 26719635 ~ 26723005 (+)
G83805 aqr,LOC108423414 non-coding downstream 33402 27133975 ~ 27140397 (+)
G83824 NA non-coding downstream 143183 27243756 ~ 27244268 (+)
G83826 NA non-coding downstream 168385 27268958 ~ 27269231 (+)
LOC107197843 NA non-coding downstream 503664 27604237 ~ 27615567 (+)
G83972 NA non-coding downstream 603681 27704254 ~ 27704881 (+)
fermt2 fermt2 other upstream 309712 26727823 ~ 26777488 (+)
spata7 NA other upstream 687933 26392890 ~ 26399267 (+)
LOC103031022 LOC103031022,LOC108423548 other upstream 759862 26321185 ~ 26327338 (+)
c9h14orf132 csgr16h14orf132,LOC108423442,LOC108269530,LOC108413331,LOC107582175 other upstream 781817 26275001 ~ 26305383 (+)
G83602 NA other upstream 833598 26235498 ~ 26253602 (+)
fam98b NA other downstream 715232 27815805 ~ 27822211 (+)
LOC103044189 LOC108423527,LOC107677688 other downstream 723683 27824256 ~ 27831584 (+)
LOC107197841 NA other downstream 1869691 28970264 ~ 28970839 (+)
LOC103045392 NA other downstream 1898929 28999502 ~ 29025114 (+)
LOC111193240 NA other downstream 1940406 29040979 ~ 29041607 (+)

Expression


Co-expression Network