G85335


Basic Information

Item Value
gene id G85335
gene name NA
gene type non-coding
species mexican tetra (Astyanax mexicanus)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_035905.1
NCBI id CM008308.1
chromosome length 42966623
location 32276045 ~ 32276309 (+)
genome version Astyanax_mexicanus-2.0_2017_mexican_tetra_Genome

Sequence

>TU114933
attgcaatgcacacaacattatgggtgacataccagagttcaaaagaggacaaattgttggtgcacgtcttgctggcgcatctgtgaccaagacagcaagtctttgtgatgcatcaagagccatggtatccagggtaatgtcagcataccaccaagaagacgaagacgaaccacatccaacaggattaactgtggacgctgtaagaggaatctgtctgaaagggatgttcgggtgctaacccggattgtatccaaaaaacataaa

Function

GO: NA

KEGG:

id description
ko04974 Protein digestion and absorption

RNA

RNA id representative length rna type GC content exon number start site end site
TU114933 True 265 lncRNA 0.45 1 32276045 32276309

Neighbor

gene id symbol gene type direction distance location
kpna5 kpna5,LOC107552832,LOC107711738,LOC107716841 coding upstream 426581 31835348 ~ 31849464 (+)
rwdd1 rwdd1,LOC107700695,LOC107587776,LOC107552826,LOC107704860 coding upstream 456193 31812267 ~ 31819852 (+)
mms22l mms22l coding upstream 516505 31712784 ~ 31759540 (+)
fbxl4 fbxl4,LOC107587770,LOC107716847 coding upstream 735130 31524951 ~ 31540915 (+)
faxc faxc coding upstream 773454 31480632 ~ 31502591 (+)
LOC103038892 NA coding downstream 143823 32420132 ~ 32425312 (+)
LOC103038371 NA coding downstream 150717 32427026 ~ 32430265 (+)
LOC103035585 LOC108423467 coding downstream 452810 32729119 ~ 32923000 (+)
LOC103035281 NA coding downstream 766536 33042845 ~ 33057697 (+)
c9h2orf71 NA coding downstream 784874 33061183 ~ 33071966 (+)
G85315 NA non-coding upstream 56109 32218864 ~ 32219936 (+)
G85317 NA non-coding upstream 99284 32176539 ~ 32176761 (+)
G85316 NA non-coding upstream 104194 32171617 ~ 32171851 (+)
G85310 NA non-coding upstream 146632 32129099 ~ 32129413 (+)
G85304 NA non-coding upstream 190301 32085203 ~ 32085744 (+)
G85337 NA non-coding downstream 7831 32284140 ~ 32284478 (+)
G85338 NA non-coding downstream 14071 32290380 ~ 32290622 (+)
G85339 NA non-coding downstream 15713 32292022 ~ 32292429 (+)
G85341 NA non-coding downstream 16211 32292520 ~ 32292909 (+)
G85360 akirin1,LOC107700743,LOC107730931,LOC107704951 non-coding downstream 99072 32375381 ~ 32391412 (+)
LOC103035447 vegfa,vegf,LOC106584182 other upstream 57283 32199183 ~ 32218762 (+)
G85189 NA other upstream 451657 31823586 ~ 31824388 (+)
LOC103034273 LOC103034273,LOC108415529 other upstream 470642 31749703 ~ 31805403 (+)
pnisr pnisr,LOC102782257 other upstream 806489 31454984 ~ 31469556 (+)
alg3 alg3,LOC107660011,LOC107730451,LOC107749127,LOC107557882,LOC107692886,LOC107600115 other upstream 1660983 30606757 ~ 30615062 (+)
LOC103037843 pnrc2,LOC108441235 other downstream 159908 32436217 ~ 32441318 (+)
G85740 zdhhc14 other downstream 2470505 34746814 ~ 34800377 (+)
tfb1m tfb1m,cldn20,LOC101886267,LOC107571061,LOC107675320,LOC107573130,LOC107728965,LOC108443299 other downstream 3011906 35288215 ~ 35339832 (+)
LOC111193254 NA other downstream 3360501 35636810 ~ 35658087 (+)
LOC111193255 NA other downstream 5207712 37484021 ~ 37503882 (+)

Expression


Co-expression Network