G85543


Basic Information

Item Value
gene id G85543
gene name NA
gene type non-coding
species mexican tetra (Astyanax mexicanus)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_035905.1
NCBI id CM008308.1
chromosome length 42966623
location 33495554 ~ 33508641 (+)
genome version Astyanax_mexicanus-2.0_2017_mexican_tetra_Genome

Sequence

>TU115197
tggctcttgatgcatcacaaagacttgctgtcttggtcaaagatgcgccagcaagacgtgcaccaacaatttgtcctcttttgaactctggtatgtcacccataatgttgtgtgcattgtttgcaatattttgagcagaactgtgctcttaacctgctaattgaaccttcacactctgctcttactggtgcaataatgtgcaattaatgaagattggccaccaggctgctccaatttagccatgaaacctcccacactaaaatgacaggtgtttcagttt

Function

GO:

id name namespace
GO:0016653 oxidoreductase activity, acting on NAD(P)H, heme protein as acceptor molecular_function
GO:0004128 cytochrome-b5 reductase activity, acting on NAD(P)H molecular_function

KEGG:

id description
ko04975 Fat digestion and absorption

RNA

RNA id representative length rna type GC content exon number start site end site
TU115197 True 280 lncRNA 0.43 2 33495554 33508641

Neighbor

gene id symbol gene type direction distance location
c9h2orf71 NA coding upstream 423588 33061183 ~ 33071966 (+)
LOC103035281 NA coding upstream 437857 33042845 ~ 33057697 (+)
LOC103035585 LOC108423467 coding upstream 572554 32729119 ~ 32923000 (+)
LOC103038371 NA coding upstream 1065289 32427026 ~ 32430265 (+)
LOC103038892 NA coding upstream 1070242 32420132 ~ 32425312 (+)
slc4a1ap NA coding downstream 322629 33831270 ~ 33849509 (+)
babam2 bre,LOC107553730,LOC107656747 coding downstream 504116 34012757 ~ 34183355 (+)
fosl2 fosl2,LOC107656746,LOC107726077,LOC107553732 coding downstream 703776 34212417 ~ 34226780 (+)
mocs1 mocs1,LOC107656745 coding downstream 734478 34243119 ~ 34264685 (+)
LOC111193251 NA coding downstream 790082 34298723 ~ 34301134 (+)
G85519 NA non-coding upstream 3593 33468240 ~ 33491961 (+)
G85515 NA non-coding upstream 138240 33309566 ~ 33357314 (+)
G85502 NA non-coding upstream 381904 33113197 ~ 33113650 (+)
G85486 NA non-coding upstream 450379 33044771 ~ 33045175 (+)
G85461 clip4,LOC107676112,LOC107731604 non-coding upstream 556921 32935238 ~ 32938633 (+)
G85553 NA non-coding downstream 45727 33554368 ~ 33554649 (+)
G85554 NA non-coding downstream 77013 33585654 ~ 33586291 (+)
G85557 NA non-coding downstream 94941 33603582 ~ 33603786 (+)
G85560 NA non-coding downstream 127599 33636240 ~ 33636573 (+)
G85565 NA non-coding downstream 171132 33679773 ~ 33680017 (+)
LOC103037843 pnrc2,LOC108441235 other upstream 1054236 32436217 ~ 32441318 (+)
LOC103035447 vegfa,vegf,LOC106584182 other upstream 1276792 32199183 ~ 32218762 (+)
G85189 NA other upstream 1671166 31823586 ~ 31824388 (+)
LOC103034273 LOC103034273,LOC108415529 other upstream 1690151 31749703 ~ 31805403 (+)
pnisr pnisr,LOC102782257 other upstream 2025998 31454984 ~ 31469556 (+)
G85740 zdhhc14 other downstream 1238173 34746814 ~ 34800377 (+)
tfb1m tfb1m,cldn20,LOC101886267,LOC107571061,LOC107675320,LOC107573130,LOC107728965,LOC108443299 other downstream 1779574 35288215 ~ 35339832 (+)
LOC111193254 NA other downstream 2128169 35636810 ~ 35658087 (+)
LOC111193255 NA other downstream 3975380 37484021 ~ 37503882 (+)
bcl11b bcl11b,bcl11ba,LOC108270293,LOC107588284 other downstream 4321114 37829755 ~ 37933289 (+)

Expression


Co-expression Network