G74306


Basic Information

Item Value
gene id G74306
gene name NA
gene type non-coding
species mexican tetra (Astyanax mexicanus)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_035904.1
NCBI id CM008307.1
chromosome length 27092187
location 16770442 ~ 16786039 (-)
genome version Astyanax_mexicanus-2.0_2017_mexican_tetra_Genome

Sequence

>TU100143
TTCTCTGAGAAGAAATGGCTTTCTTCACAGTAAGGGTAACACACCCCGGCCTGCAGGACACTGCCCCAGTCACACGTCACACAGCTCTGAGGTGTGTTATCTGCAAACAATCGCACACCCATGTCATAAAAAATCTAACAGTATTAAAAAGATGCTTAGCTAACCTCACTCTGGTTTCTGTAAGCACTAGAGTTCGTAAAAGAGGCTAAACTAATAACAAATATCACAAACCTACTTTAGGAAACTTATTTAGTTACATCAAGTTCCAATTTAAA

Function

NR:

description
PREDICTED: claudin-23-like

GO:

id name namespace
GO:0010035 response to inorganic substance biological_process
GO:0010038 response to metal ion biological_process

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU100143 True 275 lncRNA 0.40 2 16770442 16786039

Neighbor

gene id symbol gene type direction distance location
otud7a otud7a,si:dkey-37f18.2,LOC107715690,LOC107752330,LOC107659507,LOC107550219,LOC107698115,LOC107598848,LOC108275340 coding downstream 31777 16618151 ~ 16738665 (-)
LOC103042575 LOC108433637 coding downstream 242355 16489647 ~ 16528087 (-)
acsbg1 NA coding downstream 312688 16447496 ~ 16457754 (-)
cib2 cib2,LOC103027299,LOC107573330,LOC107752320,LOC101476243 coding downstream 356097 16384549 ~ 16414345 (-)
tbc1d2b tbc1d2b,LOC107698183,LOC102789207 coding downstream 420278 16317884 ~ 16350164 (-)
bnip2 bnip2,LOC107703138 coding upstream 28877 16814916 ~ 16829981 (-)
LOC103044821 anxa2,LOC108433632,LOC107739086,LOC107724175,LOC107659511,LOC107550215 coding upstream 172535 16958574 ~ 16965560 (-)
ice2 NA coding upstream 180743 16966782 ~ 16988490 (-)
LOC103045127 rora,roraa,LOC108433630,LOC106561150,LOC106573506,LOC103141220 coding upstream 206872 16992911 ~ 17425461 (-)
LOC103045440 zgc:162595,LOC108433606,LOC108275248 coding upstream 801989 17588028 ~ 17600473 (-)
G74295 NA non-coding downstream 22920 16743060 ~ 16747522 (-)
G74286 NA non-coding downstream 80085 16659503 ~ 16690357 (-)
G74285 NA non-coding downstream 128786 16640842 ~ 16641656 (-)
G74265 NA non-coding downstream 261980 16508004 ~ 16508462 (-)
G74211 NA non-coding downstream 448789 16316945 ~ 16321653 (-)
G74368 NA non-coding upstream 11006 16797045 ~ 16801051 (-)
G74407 NA non-coding upstream 468878 17254917 ~ 17255289 (-)
G74447 NA non-coding upstream 1019296 17805335 ~ 17813965 (-)
G74556 tpm1,LOC108441842 non-coding upstream 1059087 17845126 ~ 17866138 (-)
G74599 slc27a2,LOC108414297 non-coding upstream 1432250 18218289 ~ 18227676 (-)
LOC103041134 rps27l,zgc:136826,LOC107752326,LOC107598918,LOC101156845 other downstream 300119 16467089 ~ 16470323 (-)
LOC103046265 pkp3 other downstream 989764 15758303 ~ 15780678 (-)
LOC103040324 NA other downstream 1355829 15381329 ~ 15414613 (-)
LOC103037068 cpne8,LOC108274474,LOC107679956,LOC107752477,LOC107723993,LOC105026415,LOC106561599,LOC105028206 other downstream 1556158 15123814 ~ 15214284 (-)
hbp1 hbp1,LOC107732286,LOC107701066 other downstream 1973159 14709058 ~ 14797283 (-)
nrg4 NA other upstream 1090987 17877026 ~ 17885395 (-)
G74591 isl2,LOC105022634 other upstream 1196708 17982747 ~ 18029747 (-)
G74791 NA other upstream 2153135 18939174 ~ 18940464 (-)
LOC103034453 LOC108436916,LOC107753633,LOC107659484,LOC107573489,LOC107752304,LOC108181664,LOC107598834 other upstream 2206629 18992668 ~ 19008366 (-)
G74838 wasl,LOC105896696,LOC108275301 other upstream 2284899 19070938 ~ 19072888 (-)

Expression


Co-expression Network