G76472 (mpi,LOC106560745,LOC106584640)


Basic Information

Item Value
gene id G76472
gene name mpi,LOC106560745,LOC106584640
gene type non-coding
species mexican tetra (Astyanax mexicanus)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_035904.1
NCBI id CM008307.1
chromosome length 27092187
location 25323393 ~ 25327069 (+)
genome version Astyanax_mexicanus-2.0_2017_mexican_tetra_Genome

Sequence

>TU103149
TATATAGGAACTTCTTTATTCATATACCCCCCTCTGTACTCACCCTGTTGGGATGTGCCTGGATGGAGAGTGCAGTGTTGACAGACAGCACTTTAAAGAGGAAGGGGAGTTGTCCCTGGAATGTGTCTTTGACCTTGGACCCCAAGCATCCTGGGTAATCTGCAATCCACTGCCCCAGCGTCCTTTGCGATATCCTGTTGTCTTTGATGAGGGCATCGCCTTTTGGATGGGCACCCATCCATAGCTCAGCATACGGCTTTCCGCTCTCTATCACAGCCTGCGGGTCTCCACCGACAACAAGTTTAGCCACCTCGCTGTCCTGCCCCACCTTCCCCCAGGCGTAGTTCTGGACCACGCAGGACAGTGGGAACACTCTCACTTCCTCCAT

Function

symbol description
mpi Enables mannose-6-phosphate isomerase activity. Acts upstream of or within chondrocyte morphogenesis; chordate embryonic development; and liver development. Predicted to be active in cytosol. Is expressed in several structures, including female organism; margin; nervous system; neural tube; and polster. Used to study congenital disorder of glycosylation type I. Human ortholog(s) of this gene implicated in carbohydrate metabolic disorder and congenital disorder of glycosylation Ib. Orthologous to human MPI (mannose phosphate isomerase).

NR:

description
PREDICTED: mannose-6-phosphate isomerase

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU103149 True 388 lncRNA 0.53 3 25323393 25327069

Neighbor

gene id symbol gene type direction distance location
LOC103027043 LOC108429467,LOC108275406 coding upstream 7078 25313291 ~ 25316315 (+)
LOC103045999 LOC108429466,LOC106561822 coding upstream 11230 25302235 ~ 25312163 (+)
LOC111193062 NA coding upstream 52139 25269678 ~ 25271254 (+)
hps5 hps5,LOC106584758 coding upstream 60178 25249630 ~ 25263215 (+)
gtf2h1 gtf2h1,LOC107572319 coding upstream 76615 25236419 ~ 25246778 (+)
LOC103046607 scamp2 coding downstream 497 25327566 ~ 25346047 (+)
adpgk adpgk,LOC107549595,LOC107569355,LOC107754317 coding downstream 279718 25606787 ~ 25613446 (+)
LOC103023612 NA coding downstream 353024 25680093 ~ 25700055 (+)
dennd2a dennd2a,LOC107701048,LOC107724656,LOC107549597,LOC107669049 coding downstream 399882 25726951 ~ 25778572 (+)
LOC103024360 tead4,LOC101167205,LOC108246608,LOC107549581,LOC107669037,LOC103024360,LOC108429458,LOC103380343 coding downstream 469369 25796438 ~ 25830701 (+)
G76468 NA non-coding upstream 4736 25317195 ~ 25318657 (+)
G76463 NA non-coding upstream 29465 25293405 ~ 25293928 (+)
G76367 NA non-coding upstream 339002 24984152 ~ 24984391 (+)
G76349 NA non-coding upstream 400953 24921135 ~ 24922440 (+)
LOC111193114 NA non-coding upstream 612442 24566804 ~ 24710951 (+)
G76505 neo1,LOC108275206 non-coding downstream 29195 25356264 ~ 25359567 (+)
G76514 neo1,LOC108275206 non-coding downstream 58218 25385287 ~ 25390947 (+)
G76526 NA non-coding downstream 223776 25550845 ~ 25551311 (+)
G76539 NA non-coding downstream 308762 25635831 ~ 25642628 (+)
G76540 NA non-coding downstream 309411 25636480 ~ 25643923 (+)
G76464 NA other upstream 26925 25294501 ~ 25296468 (+)
LOC103026466 LOC108429386,LOC108274988 other upstream 42022 25271256 ~ 25281371 (+)
G76423 NA other upstream 138661 25184085 ~ 25184732 (+)
LOC103022708 NA other upstream 318878 24988396 ~ 25004515 (+)
LOC103022391 parvb,LOC108432702 other upstream 339679 24974941 ~ 24983714 (+)

Expression


Co-expression Network