LOC111193115


Basic Information

Item Value
gene id LOC111193115
gene name NA
gene type non-coding
species mexican tetra (Astyanax mexicanus)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_035904.1
NCBI id CM008307.1
chromosome length 27092187
location 25637072 ~ 25639133 (-)
genome version Astyanax_mexicanus-2.0_2017_mexican_tetra_Genome

Sequence

>XR_002650275.1
ATGATAGTGCACTCCTGTTCGCCTGGCCGAGTCCTGCGCGGGCTGCTGGCCGGTGGATTCAGACACAGAAACCCTGCCACCAGGGCAGCCACTGCACTATGTCTAAATAGGCTAGTGCATGTGAGGGGGGCATCCCGTGTGCTGAAGGGCAGGACATTTACCAGGAAGATCCTTCCTGCCATCAGCACACTGGCGTTCGACGCTGCCGAGGAAGTGAGGACTCCTGCCCGAGCCGCCTTACGGTTTTTGGGCGGGCACAGAGAGGCTGCGGCAGCGGTGGAAAAATTTGTTTCCATTAGAGATCAGGCCTC

Function

GO:

id name namespace
GO:0044093 positive regulation of molecular function biological_process
GO:0043085 positive regulation of catalytic activity biological_process
GO:0050790 regulation of catalytic activity biological_process

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
XR_002650275.1 True 311 lncRNA 0.59 3 25637072 25639133

Neighbor

gene id symbol gene type direction distance location
bbs4 bbs4,LOC107754319,LOC107701057 coding downstream 5301 25615420 ~ 25631771 (-)
LOC103047119 neo1,LOC108275206 coding downstream 75125 25351525 ~ 25561947 (-)
mpi mpi,LOC106560745,LOC106584640 coding downstream 309519 25317126 ~ 25327553 (-)
LOC103023960 kiaa1644,LOC108274641 coding downstream 535972 25013293 ~ 25101100 (-)
LOC107197705 NA coding downstream 687050 24949044 ~ 24950022 (-)
adck2 adck2,LOC107669038 coding upstream 16632 25655765 ~ 25661625 (-)
mrps35 mrps35 coding upstream 205484 25844617 ~ 25857522 (-)
cdkn1b NA coding upstream 433964 26073097 ~ 26077993 (-)
yars2 yars2 coding upstream 440243 26079376 ~ 26085001 (-)
LOC103026228 LOC108429453,LOC107558597,LOC107549599,LOC107701195,LOC107668648,LOC105913426 coding upstream 452129 26091262 ~ 26134844 (-)
G76585 adpgk,LOC107549595,LOC107745566,LOC107569355 non-coding downstream 21721 25612125 ~ 25615351 (-)
G76579 NA non-coding downstream 40409 25596425 ~ 25596663 (-)
G76570 NA non-coding downstream 72642 25529824 ~ 25564430 (-)
G76453 NA non-coding downstream 399059 25236454 ~ 25238013 (-)
G76438 NA non-coding downstream 424046 25207830 ~ 25213026 (-)
LOC111193116 NA non-coding upstream 814 25639947 ~ 25641133 (-)
G76595 NA non-coding upstream 74350 25713483 ~ 25713920 (-)
G76676 NA non-coding upstream 123389 25762522 ~ 25830697 (-)
G76701 NA non-coding upstream 439305 26078438 ~ 26079115 (-)
G76706 NA non-coding upstream 448219 26087352 ~ 26102108 (-)
rab3il1 rab3il1,LOC108429468,LOC107549590 other downstream 335304 25282789 ~ 25301768 (-)
G76424 NA other downstream 452603 25184209 ~ 25184469 (-)
G76377 NA other downstream 716707 24914298 ~ 24920365 (-)
LOC103025724 tmem80 other downstream 838456 24791192 ~ 24798616 (-)
deaf1 deaf1,LOC107726848 other downstream 1376542 24240898 ~ 24260530 (-)
LOC103031319 coro2b,LOC108412540,LOC105018662,LOC107549656,LOC107738688 other upstream 1217496 26856629 ~ 26878862 (-)

Expression


Co-expression Network