G9868 (tnpo2,LOC104950577,LOC103360699,LOC108432206)


Basic Information

Item Value
gene id G9868
gene name tnpo2,LOC104950577,LOC103360699,LOC108432206
gene type non-coding
species mexican tetra (Astyanax mexicanus)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_035898.1
NCBI id CM008301.1
chromosome length 34292151
location 12274840 ~ 12276812 (+)
genome version Astyanax_mexicanus-2.0_2017_mexican_tetra_Genome

Sequence

>TU13385
GGTCGATACGGACTTCCAGCAGCATGACCAGCGCCCGGCACACGTTCTTCCTCACCTCAGAGTCCTCGTCTGCAGCCAGCGCAAACAGACTCTCAATAAAGGTATCGATATTGTCCATCAGCGCCTGTGCTCTACCAATGATGAACTGGTTCACACAAGCGATGGCATGAGATCTGATCTTGGGACTACAGTGCTTGAAGAACTGCAGGAACTTGGGGATCATGATGTTTAGTGGCCGGTTCAGCGCATCACTGTCTAGCAGCTCTGAGGAGTCCTCACAGATCTTCTGCAGAGCTCCAAATGAGCCCTCGCAGGTGTTATAATCCTCAGAGTTGAGCAAGTTGCAGAGTTGTGGGAGCAGCTCAGGCCAGGTCTGCAGCTCCCCTTTTGAAGCGATGGTTGTGATCAGG

Function

symbol description
tnpo2 Predicted to enable nuclear import signal receptor activity and nuclear localization sequence binding activity. Predicted to be involved in protein import into nucleus. Predicted to act upstream of or within intracellular protein transport. Predicted to be active in cytoplasm and nucleus. Orthologous to human TNPO2 (transportin 2).

NR:

description
PREDICTED: transportin-2-like

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU13385 True 410 lncRNA 0.38 4 12274840 12276812

Neighbor

gene id symbol gene type direction distance location
LOC103025257 grin2c,LOC100329743,LOC107758122,LOC107658706,LOC107559244 coding upstream 204428 11943718 ~ 12070412 (+)
LOC103023317 LOC108432209,LOC108260824 coding upstream 357565 11882731 ~ 11917275 (+)
LOC103046201 s1pr5a,LOC108432217,LOC107728470,LOC107658699,LOC107577264,LOC107758128,LOC107703889 coding upstream 524631 11744412 ~ 11750209 (+)
LOC103045592 NA coding upstream 642940 11623683 ~ 11631900 (+)
hmgxb4 hmgxb4,LOC106607053,LOC106601319 coding upstream 652498 11606124 ~ 11622342 (+)
gaa LOC106601771 coding downstream 6458 12283270 ~ 12301714 (+)
LOC103031044 NA coding downstream 175091 12451903 ~ 12463253 (+)
LOC103029671 cbx8,LOC108432169,LOC102784560 coding downstream 191838 12468650 ~ 12471254 (+)
LOC111188181 LOC108432168 coding downstream 197405 12474217 ~ 12484578 (+)
mybpc2 mybpc2,LOC107729557,LOC107687621,LOC107680879,LOC107732898 coding downstream 619084 12895896 ~ 13001095 (+)
G9861 tnpo2,LOC108432206 non-coding upstream 1919 12265778 ~ 12272921 (+)
G9856 NA non-coding upstream 50150 12223700 ~ 12224690 (+)
G9852 NA non-coding upstream 76671 12151905 ~ 12198169 (+)
G9851 NA non-coding upstream 157497 12117017 ~ 12117343 (+)
G9787 NA non-coding upstream 432647 11837640 ~ 11842193 (+)
G9870 tnpo2,LOC108432206,LOC105910653,LOC106601762 non-coding downstream 727 12277539 ~ 12280340 (+)
G9918 NA non-coding downstream 67808 12344620 ~ 12348777 (+)
G9999 NA non-coding downstream 309276 12586088 ~ 12589528 (+)
LOC111193353 NA non-coding downstream 319585 12596397 ~ 12597719 (+)
G10001 slc5a11,LOC107670676,LOC107728787 non-coding downstream 332153 12608965 ~ 12610876 (+)
luc7l3 luc7l3,LOC107674472,LOC107726809,LOC107654661 other upstream 836508 11429073 ~ 11438332 (+)
LOC111193317 gas7,LOC108412615,LOC108260882,LOC107755169,LOC107555645,LOC105910950 other upstream 2245250 9979075 ~ 10029590 (+)
LOC103034760 LOC108412745,LOC108274115,LOC107724740,LOC107713951,LOC107584184,LOC103382335,LOC100706789,LOC102782950,LOC103361753 other upstream 2663028 9499833 ~ 9611812 (+)
bri3 bri3 other upstream 3343835 8919829 ~ 8931005 (+)
G9113 NA other upstream 3464373 8809701 ~ 8810467 (+)
tbc1d16 tbc1d16,LOC107559246,LOC107689993,LOC107670685,LOC107562324,LOC107758097 other downstream 25715 12302527 ~ 12381348 (+)
arhgap17 LOC108432202,LOC108279379 other downstream 250877 12527689 ~ 12600530 (+)
G10003 NA other downstream 336879 12613691 ~ 12618197 (+)
akt1s1 akt1s1,LOC107564011,LOC107680841 other downstream 497401 12774213 ~ 12821991 (+)
G10200 LOC107747660 other downstream 857789 13134601 ~ 13135118 (+)

Expression


Co-expression Network