G13291


Basic Information

Item Value
gene id G13291
gene name NA
gene type non-coding
species mexican tetra (Astyanax mexicanus)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_035898.1
NCBI id CM008301.1
chromosome length 34292151
location 23572041 ~ 23620191 (-)
genome version Astyanax_mexicanus-2.0_2017_mexican_tetra_Genome

Sequence

>TU17842
tgaacttcagagcagctgtttactctccactccagcaaaagatgctccacatatgagctgctaactcatccatttccctttataaagctacgagtctctcctctctctaatatgagggtttttgttgttggtgaagaaggaggcgtttatacaggtatcaatgtgcagcatgtgagacggtgtttcaggaacagatttgagcaaaaaaatcagat

Function

GO:

id name namespace
GO:0046685 response to arsenic-containing substance biological_process

KEGG:

id description
ko00010 Glycolysis / Gluconeogenesis

RNA

RNA id representative length rna type GC content exon number start site end site
TU17842 True 215 lncRNA 0.42 2 23572041 23620191

Neighbor

gene id symbol gene type direction distance location
LOC111194286 LOC108277598 coding downstream 1288939 22269223 ~ 22283102 (-)
LOC111194282 LOC108277600 coding downstream 1302813 22258919 ~ 22269228 (-)
LOC103037608 LOC108277452 coding downstream 1324582 22205062 ~ 22247459 (-)
LOC103032877 NA coding downstream 1380504 22179416 ~ 22191537 (-)
scn3b NA coding downstream 1407472 22141770 ~ 22164569 (-)
LOC103035063 NA coding upstream 30226 23650417 ~ 23724768 (-)
c1qtnf5 c1qtnf5 coding upstream 146836 23767027 ~ 23775316 (-)
ube4a ube4a,LOC107718272,LOC107690452 coding upstream 239562 23859753 ~ 23895075 (-)
LOC103036322 LOC108439975 coding upstream 289220 23909411 ~ 23927376 (-)
nlrx1 nlrx1 coding upstream 308624 23928815 ~ 23947378 (-)
LOC103031983 NA non-coding downstream 35223 23528299 ~ 23536818 (-)
G13268 NA non-coding downstream 43975 23526236 ~ 23528066 (-)
G12951 NA non-coding downstream 480200 23091598 ~ 23091841 (-)
G12946 NA non-coding downstream 484378 22988534 ~ 23087663 (-)
G12890 NA non-coding downstream 606809 22933782 ~ 22965232 (-)
G13303 NA non-coding upstream 54019 23674210 ~ 23724463 (-)
G13304 NA non-coding upstream 95249 23715440 ~ 23820870 (-)
G13305 NA non-coding upstream 100393 23720584 ~ 23721069 (-)
G13307 NA non-coding upstream 130279 23750470 ~ 23752519 (-)
G13311 NA non-coding upstream 133360 23753551 ~ 23754490 (-)
LOC111193708 NA other downstream 18071 23539257 ~ 23553970 (-)
G12767 NA other downstream 1577290 21993807 ~ 21994751 (-)
trnak-cuu NA other downstream 2596887 20975082 ~ 20975154 (-)
G11917 NA other downstream 3489599 19998440 ~ 20082442 (-)
jam3 jam3,jam3a,LOC107699899,LOC107597526,LOC107662760,LOC107713445 other downstream 3769718 19785981 ~ 19802323 (-)
LOC103035686 kmt2a other upstream 164280 23784471 ~ 23853298 (-)
G13322 phykpl,LOC108439974,LOC108277665,LOC107585546,LOC107743705,LOC107683819 other upstream 283992 23904183 ~ 23908771 (-)
spcs2 spcs2,LOC107677086 other upstream 1430769 25050960 ~ 25056101 (-)
G13630 atp1b3b,LOC108277440,LOC107680094,LOC107704304,LOC107720962,LOC108426936,LOC107563006 other upstream 1853543 25473734 ~ 25496958 (-)
LOC111193738 NA other upstream 1903596 25523787 ~ 25524603 (-)

Expression


Co-expression Network